[PDF] UNIVERSITÀ DEGLI STUDI DI ROMA \\\ (2025)

1 UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA" FACOLTA' DI MEDICINA E CHIRURGIA DOTTORATO DI RICERCA IN...

UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA" FACOLTA' DI MEDICINA E CHIRURGIA DOTTORATO DI RICERCA IN EMATOLOGIA

XXII

Investigation on the mechanisms underlying the chromosomal translocations in therapy-related acute myeloid leukemias

Syed Khizer Hasan

A.A. 2009/2010

Docente Guida/Tutor: Prof. Francesco Lo-Coco Coordinatore: Prof. Sergio Amadori

Index Chapter 1: Introduction 1.1

Page 4

Acute promyelocytic leukemia (APL) and therapy related APL (t-APL)

Page 6

1.2

Therapy related acute myeloid leukemia

Page 8

1.3

t-APL following multiple sclerosis and genetic variants of DNA double strand break repair genes

Page 9

1.4

Aims and objectives

Page 10

1.5

References to chapter 1

Page 11

Chapter 2: Mechanisms of the formation of t(15;17) in mitoxantrone related therapy related-APL following multiple sclerosis

Page 14

Chapter 3: Molecular analysis of the t(15;17) genomic breakpoints in epirubicin associated therapy-related APL following breast carcinoma

Page 30

Chapter 4: Analysis of t(15;17) chromosomal breakpoint sequences in therapy-related versus de novo APL

Page 41

Chapter 5: Genomic characterization of t(16;21) translocation in therapy-related acute myeloid leukemia

Page 49

Chapter 6: To study the genetic markers of susceptibility to t-APL and their association with multiple sclerosis

Page 59

Chapter 7: Conclusions and future directions

Page 83

Chapter 1 Introduction

Introduction Therapy-related leukemias are well-recognized clinical syndrome occurring as a late complication following cytotoxic therapy. The term "therapy-related" leukemia is descriptive and based on a patient’s history of exposure to cytotoxic agents. Although a causal relationship is implied, the mechanism remains to be proven. These leukemias are thought to be the direct consequence of mutational events induced by cytotoxic therapy, or via the selection of a myeloid clone with a mutator phenotype that has a markedly elevated risk for a mutational event. These types of leukaemias are becoming an increasing healthcare problem as more patients survive their primary cancers. The nature of the causative agent has an important bearing upon the characteristics, biology, time to onset and prognosis of the resultant leukaemia. Agents targeting topoisomerase II induce acute leukaemias with balanced translocations that generally arise within 3 years, often involving the MLL, RUNX1, PML and RARA loci at 11q23, 21q22 15q22 and 17q21 respectively. Chromosomal breakpoints have been found to be preferential sites of topoisomerase II cleavage, which are believed to be repaired by the nonhomologous end-joining DNA repair pathway to generate chimaeric oncoproteins that underlie the resultant leukaemias. Therapy-related acute myeloid leukaemias occurring after exposure to antimetabolites and/or alkylating agents are biologically distinct with a longer latency period, being characterised by more complex karyotypes and loss of p53. The treatment of therapy-related leukaemias represents a considerable challenge due to prior therapy and comorbidities, however, curative therapy is possible, particularly in those with favourable karyotypic features. Although the transforming function of leukemia-associated fusion proteins has been widely studied, little is known about the mechanisms that cause the underlying translocations. In this respect, insights can be gained from investigations of secondary leukemias, all of which have counterparts in primary leukemias1.

1.1

Acute

promyelocytic

leukemia

(APL)

and

therapy-related

APL

t(15;17)(q22;q21) In 1977, Rowley et al2 from the University of Chicago reported on the consistent occurrence of a chromosomal translocation t(15;17)(q22;q21) in APL. This aberration was subsequently found to be uniquely associated to, and therefore pathognomonic of the disease. Upon cloning of the translocation in the late „80s, it was shown that chromosome breakpoints lie within the RAR

locus on chromosome 17 and the PML locus on

chromosome 15, resulting in the fusion of the two genes3,4. APL is a particular leukemia subset characterized by a unique genetic lesion, i.e the PML-RARα fusion, and an exquisite response to differentiating agents. Until the late 80‟s, APL was considered the most aggressive and rapidly fatal form of acute leukemia. Over the past two decades, important advances have been made into the understanding of APL pathogenesis as well as in its treatment, such that it has been nowadays converted into the most frequently curable leukemia in adults. APL is regarded as a model disease for innovative tailored treatment of human leukemia including differentiation therapy and the use of chromatin remodeling agents and antibody-directed therapy. The occurrence of APL as a second tumor (sAPL) has been increasingly reported in recent years, most commonly developing in patients receiving chemotherapy and/or radiotherapy for breast cancer or, less frequently, for other primary tumors (including prostate, uterus, ovary)5-8. Chemotherapy associated with development of sAPL usually induces DNA damage through targeting of topoisomerase II (topoII), with mitoxantrone, etoposide and epirubicin being the most commonly implicated agents5-10. More recently, a number of reports have been published describing the occurrence of sAPL in patients with Multiple Sclerosis

(MS) most

of whom received mitoxantrone given

immunosuppressive agent for their primary disease

11-16

. Because only case reports have

been published and no systematic analysis has been performed so far, the true incidence of sAPL in MS patients treated with mitoxantrone is unknown. In addition, it is unclear at present whether factors other than chemotherapy may play a role in sAPL development in patients with MS. In a study reported by Mistry et al10 breakpoints in sAPL cases arising following mitoxantrone exposure for prior breast carcinoma were found to be clustered in an 8bp region within PML intron 6. In functional assays, this “hotspot” was found to correspond to a preferential site of mitoxantrone-induced topoII-dependent cleavage at PML nucleotide position 1484. These findings suggest a direct causative role of mitoxantrone in stimulating topoII-mediated cleavage within the PML gene thus implying a direct link between this agent and the formation of the t(15;17) chromosome translocation that is the hallmark of APL. However, the precise mechanisms leading to this aberration and therefore to APL development needs to be further clarified. In fact, several reports have described the occurrence of sAPL in patients treated with surgery alone for their primary tumor 6. Neither in these cases nor in patients developing sAPL after treatment of MS has the t(15;17) translocation been investigated at the molecular level. Finally, no studies have analysed in details the response to endogenous or exogenous DNA damage in newly diagnosed APL and in sAPL. DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or in a wide variety of genetic alterations including large or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss.

Mitoxantrone creates exogenous

DNA double strands breaks (DSBs) and interferes in the cleavage-religation equilibrium of the topoII enzyme17. The maintenance of genomic integrity and the prevention of tumor progression depend on the co-ordination of DNA repair mechanisms and cell cycle checkpoint signaling in an overall DNA damage response. It is believed that double strand

breaks (DSBs) are initially detected by specific sensors (e.g. MRN complex) that trigger the activation of transducing kinases (e.g. ATM, ATR, DNAPK). These transducers in coordination with mediators (e.g. H2AX) amplify the damage signal, which is then relayed to effector proteins (e.g. p53, SMC1, Kap1, CHK2, CHK1), that directly regulate the progression of the cell cycle and DNA repair. DSBs are normally repaired by nonhomologous end-joining (NHEJ) and homologous recombination (HR) pathways. Disruption of the repair proteins may lead the NHEJ pathway to function inappropriately and rejoin DNA ends incorrectly resulting in translocations18. The NHEJ is an error prone pathway in which rejoinings occur at regions of microhomology that are 1–4 nucleotides in length. These are nucleotides that, by chance, are shared between the two ends of different chromosomes. We and others have demonstrated the presence of short homologies at t(15;17) translocation breakpoint junction suggesting that PML and RARA joining may have been mediated by the classical NHEJ pathway10,19-20

1.2 Therapy related acute myeloid leukemia with t(16;21) (q24;q22) Hematopoietic malignancies are frequently characterized by recurrent chromosomal translocations involving genes that play an important role in the regulation of hematopoietic cell proliferation and differentiation21. The AML1 (RUNX1) gene at cytogenetic band 21q22 is one of the most frequent targets of chromosomal translocations observed in both de novo acute leukemia and therapy-related myelodysplastic syndrome (t-MDS) and acute myeloid leukemia (t-AML). Translocations involving AML1 have been reported in up to 15% of tMDS/t-AML cases and the most common chromosome/gene rearrangements described in this clinical context are the t(8;21)(q22;q22), t(3;21)(q26;q22) and t(16;21)(q24;q22) translocations involving the ETO-1 (MTG8), EAP/MDS1/EVI1, and MTG16 (ETO-2) genes, respectively22.

The t(16;21)(q24;q22) is a rare but non random chromosome abnormality associated mostly with t-AML23-25. It involves MTG16 (myeloid translocation gene on chromosome 16) which encodes one of a family of novel transcriptional corepressors (MTG proteins) and shows a high degree of homology to the MTG8 gene, the fusion partner in the t(8;21)24 . The evolutionary conserved structural features between AML1-MTG8 and AML1-MTG1624, suggests that the two chimeric proteins are both involved in hematopoiesis, as subsequently demonstrated in functional studies26.

1.3 t-APL following multiple sclerosis and genetic variants of DNA double strand break repair genes The occurrence of APL as a second tumor has been increasingly reported in patients with Multiple Sclerosis (MS). It is believed that the genetic contribution to leukemia susceptibility is a complex interplay of environmental exposures and many susceptibility alleles, each of which contributes only a small amount to overall risk. Multiple genetic variants, deriving from Single Nucleotide Polymorphisms (SNPs) within coding sequences, have been described for many genes involved in DNA repair processes. Such variants may be associated with functional differences of the encoded proteins, which may in turn be responsible for inefficient DNA repair mechanisms that become evident particularly after exposure to chemotherapeutic agents. Furthermore, specific SNP variants of apoptosis and DNA damage-regulatory genes have recently been described as risk factors for MS and may hence be associated with sAPL occurring in patients with this disease. We, therefore, intend to investigate the possibility that specific genetic variants in DNA repair genes or genes that predispose to MS are significantly associated with t-APL.

1.4 Aims and objectives We aim to investigate whether specific chromosomal regions are particularly susceptible to DNA damage (either spontaneously or induced by chemotherapeutic agents). In particular, we proposed: a) To determine the mechanism of chromosomal translocations of t(15;17) and t(16,21) in therapy related acute leukemia through characterization of DNA breakpoint regions using patient samples. b) To provide evidences of mitoxantrone and epirubicin induced DNA cleavage at translocation breakpoint loci using in vitro DNA cleavage assays. c) To compare the translocation breakpoint distribution between de novo and t-APL. d) To analyse genetic variability of genes involved in DNA double strand break repair in multiple sclerosis patients and t-APL developing after multiple sclerosis.

References: 1. Larson RA. Is secondary leukemia an independent poor prognostic factor in acute myeloid leukemia? Best Pract Res Clin Haematol 2007; 10: 29-37 2. Rowley JD, Golomb HM, Dougherty C. 15/17 translocation, a consistent chromosomal change in acute promyelocytic leukaemia. Lancet 1977; 1: 549-550. 3. de The H, Chomienne C, Lanotte M, Degos L, Dejean A. The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha gene to a novel transcribed locus. Nature 1990; 347: 558-561. 4.

Kakizuka A, Miller WH, Jr., Umesono K, Warrell RP, Jr., Frankel SR, et al. Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 1991; 66: 663-674.

5. Pollicardo N, O'Brien S, Estey EH et al. Secondary acute promyelocytic leukemia: Characteristics and prognosis of 14 patients from a single institution. Leukemia 1996; 10: 27-31 6.

Pulsoni A, Pagano L, Lo Coco F et al. Clinico-biological features and outcome of acute promyelocytic leukemia occurring as a second tumor: the GIMEMA experience. Blood 2002;100:1972-76

7. Beaumont M, Sanz M, Carli PM et al. Therapy related acute promyelocytic leukemia. J Clin Oncol 2003; 21: 2123-2137 8. Andersen MK, Larson RA, Mauritzson N et al. Balanced chromosome abnormalities inv(16) and t(15;17) in therapy-related myelodysplastic syndromes and acute leukemia: Report from an International Workshop. Genes Chromosomes Cancer 2002:33395-400 9. Felix CA, Kolaris CP, Osheroff

N. Topoisomease II and the etiology of

chromosomal translocations. DNA repair 2006; 5 : 1093-1108

10. Mistry AR, Felix CA, Whitmarsh RJ et al. DNA topoisomerase II in therapy-related acute promyelocytic leukemia. N Engl J Med 2005; 352: 1529-1538 11. Vicari AM, Ciceri F, Folli F et al. Acute promyelocytic leukemia following mitoxantrone as single agent for the treatment of multiple sclerosis. Leukemia 1998; 12:441-442 12. Cattaneo C, Almici C, Borlenghi E et al. A case of acute promyelocytic leukemia following mitoxantrone treatment of multiple sclerosis. Leukemia 2003; 17: 985-986 13. B Delisse, J de Seze, A Mackowiak et al. Therapy related acute myeloblastic leukemia after mitoxantrone treatment in a patient with multiple sclerosis. Mult scler 2004; 10: 92 14. Novoselac AV, Reddy S, Sanmugarajah J. Acute promyelocytic leukemia in a patient with multiple sclerosis following treatment with mitoxantrone. Leukemia 2004; 18: 1561-1562 15. Arruda WO, Montú MB, de Oliveira Mde S et al. Acute myeloid leukemia induced by mitoxantrone: case report. Arq Neuropsiquiatr 2005; 63: 327-329 16. . Ledda A, Caocci G, Spinicci G et al. Two new cases of acute promyelocytic leukemia following mitoxantrone treatment in patients with multiple sclerosis. Leukemia 2006; 20: 2217 17. Fortune JM, Osheroff N. Topoisomerase II as a target for anticancer drugs: when enzyme stops being nice. Prog Nucleic Acid Res Mol Biol 2000;64: 221-53 18. Soutoglou E, Dorn JF, Sengupta K et al. Positional stability of single double strands breaks in mammalian cellls Nat Cell Biol. 2007; 9: 675-82 19. Hasan SK, Mays A, Ottone T et al. Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis Submitted to Blood 2008; 112: 3383-90

20. Reiter A, Saussele S, Grimwade D et al. Genomic anatomy of the specific reciprocal translocation t(15;17) in acute promyelocytic leukemia. Genes Chromosomes Cancer 2003;36(2):175-88. 21. Renneville A, Roumier C, Biggio V, Nibourel O, Boissel N, Fenaux P, Preudhomme C. Cooperating gene mutations in acute myeloid leukemia: a review of the literature. Leukemia 2008; 22:915-931. 22. Slovak ML, Bedell V, Popplewell L, Arber DA, Schoch C, Slater R. 21q22 balanced chromosome aberrations in therapy-related hematopoietic disorders: report from an international workshop. Genes Chromosomes and Cancer 2002; 33: 379-294. 23. Nucifora G, Rowley JD. AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia. Blood 1995 ; 86:1-14. 24. Gamou T, Kitamura E, Hosoda F, Shimizu K, Shinohara K, Hayashi Y, Nagase T, Yokoyama Y, Ohki M. The partner gene of AML1 in t(16;21) myeloid malignancies is a novel member of the MTG8(ETO) family. Blood 1998; 9 : 4028-4037. 25. Roulston D, Espinosa R 3rd, Nucifora G, Larson RA, Le Beau MM, Rowley JD. CBFA2(AML1) translocations with novel partner chromosomes in myeloid leukemias: association with prior therapy. Blood 1998; 92:2879-2885. 26. Rossetti S, Van Unen L, Touw IP, Hoogeveen AT, Sacchi N. Myeloid maturation block by AML1-MTG16 is associated with Csf1r epigenetic down regulation. Oncogene 2006; 24:5325-5332.

Chapter 2 Mechanisms of the formation of t(15;17) in mitoxantrone related therapy related-APL following multiple sclerosis

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only.

2008 112: 3383-3390 Prepublished online Jul 23, 2008; doi:10.1182/blood-2007-10-115600

Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis Syed Khizer Hasan, Ashley N. Mays, Tiziana Ottone, Antonio Ledda, Giorgio La Nasa, Chiara Cattaneo, Erika Borlenghi, Lorella Melillo, Enrico Montefusco, José Cervera, Christopher Stephen, Gnanam Satchi, Anne Lennard, Marta Libura, Jo Ann W. Byl, Neil Osheroff, Sergio Amadori, Carolyn A. Felix, Maria Teresa Voso, Wolfgang R. Sperr, Jordi Esteve, Miguel A. Sanz, David Grimwade and Francesco Lo-Coco

Updated information and services can be found at: http://bloodjournal.hematologylibrary.org/cgi/content/full/112/8/3383 Articles on similar topics may be found in the following Blood collections: Neoplasia (4221 articles) Clinical Trials and Observations (2490 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/misc/rights.dtl#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/misc/rights.dtl#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/subscriptions/index.dtl

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published semimonthly by the American Society of Hematology, 1900 M St, NW, Suite 200, Washington DC 20036. Copyright 2007 by The American Society of Hematology; all rights reserved.

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. NEOPLASIA

Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis *Syed Khizer Hasan,1 *Ashley N. Mays,2 Tiziana Ottone,1 Antonio Ledda,3 Giorgio La Nasa,3 Chiara Cattaneo,4 Erika Borlenghi,4 Lorella Melillo,5 Enrico Montefusco,6 Jose´ Cervera,7 Christopher Stephen,8 Gnanam Satchi,9 Anne Lennard,10 Marta Libura,2 Jo Ann W. Byl,11 Neil Osheroff,11 Sergio Amadori,1 Carolyn A. Felix,12 Maria Teresa Voso,13 Wolfgang R. Sperr,14 Jordi Esteve,15 Miguel A. Sanz,7 David Grimwade,2 and Francesco Lo-Coco1 1Department

of Biopathology, University of Tor Vergata, Rome, Italy; 2Department of Medical & Molecular Genetics, King’s College London School of Medicine, London, United Kingdom; 3Ematologia/Centro Trapianti Midollo Osseo, Ospedale R. Binaghi, Cagliari, Italy; 4Ematologia, Spedali Civili, Brescia, Italy; 5Hematology Department, Casa Sollievo della Sofferenza Hospital, S. Giovanni Rotondo, Italy; 6Department of Hematology, S. Andrea Hospital, University La Sapienza, Rome, Italy; 7Hematology Department, University Hospital La Fe, Valencia, Spain; 8Department of Haematology, Pilgrim Hospital, Boston, United Kingdom; 9Department of Haematology, Whiston Hospital, Prescot, United Kingdom; 10Department of Haematology, Royal Victoria Infirmary, Newcastle, United Kingdom; 11Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN; 12Department of Pediatrics, University of Pennsylvania School of Medicine, Division of Oncology, Children’s Hospital of Philadelphia, Philadelphia, PA; 13Istituto di Ematologia, Universita’ Cattolica del Sacro Cuore, Rome, Italy; 14Department of Internal Medicine I, Division of Hematology & Hemostaseology, Medical, University of Vienna, Vienna, Austria; and 15Hospital Clı´nic, Institut d’Investigacions Biome`diques August Pi i Sunyer, Barcelona, Spain

Therapy-related acute promyelocytic leukemia (t-APL) with t(15;17) translocation is a well-recognized complication of cancer treatment with agents targeting topoisomerase II. However, cases are emerging after mitoxantrone therapy for multiple sclerosis (MS). Analysis of 12 cases of mitoxantrone-related t-APL in MS patients revealed an altered distribution of chromosome 15 breakpoints versus de novo APL, biased toward disruption within PML intron 6 (11 of 12, 92% vs 622 of 1022, 61%: P ⴝ .035). Despite this intron span-

ning approximately 1 kb, breakpoints in 5 mitoxantrone-treated patients fell within an 8-bp region (1482-9) corresponding to the “hotspot” previously reported in tAPL, complicating mitoxantrone-containing breast cancer therapy. Another shared breakpoint was identified within the approximately 17-kb RARA intron 2 involving 2 t-APL cases arising after mitoxantrone treatment for MS and breast cancer, respectively. Analysis of PML and RARA genomic breakpoints in functional assays in 4 cases, including the shared

RARA intron 2 breakpoint at 14 446-49, confirmed each to be preferential sites of topoisomerase II␣-mediated DNA cleavage in the presence of mitoxantrone. This study further supports the presence of preferential sites of DNA damage induced by mitoxantrone in PML and RARA genes that may underlie the propensity to develop this subtype of leukemia after exposure to this agent. (Blood. 2008;112: 3383-3390)

Introduction The occurrence of acute promyelocytic leukemia (APL) as a second tumor (sAPL) frequently has been reported as a late complication of chemotherapy and/or radiotherapy (therapyrelated APL [t-APL]), although sAPL cases arising in patients whose primary tumors were treated by surgery alone have also been described.1-3 The agents most often associated with development of t-APL induce DNA damage through targeting of topoisomerase II, with mitoxantrone, epirubicin, adriamycin, and etoposide being most commonly implicated.3,4 The latency period between chemotherapy exposure and the onset of t-APL is relatively short (⬍ 3 years) and typically occurs without a preceding myelodysplastic phase.3,4 In a study by Mistry et al5 concerning molecular mechanisms underlying formation of the t(15;17) in t-APL, breakpoints in cases arising after mitoxantrone exposure for prior breast carcinoma were found to be clustered in an 8-bp region within PML intron 6; this corresponded in functional assays to a preferential site of mitoxantrone-induced topoisomerase II–dependent cleavage at

position 1484. Although these findings highlighted the leukemogenic role of drug-induced DNA cleavage at specific sites in the genome, the precise mechanism by which secondary leukemias with balanced chromosomal translocations such as the t(15;17) in APL develop remains controversial.6-9 This is compounded by the fact that many patients have been exposed to multiple cytotoxic drugs often accompanied by radiotherapy, making it difficult to categorically ascribe the etiology of therapy-related acute myeloid leukemia (t-AML) in any given case. Previous studies on t-AML have focused on patient populations that feasibly could have been enriched for persons at particular risk of leukemia, having already developed one form of cancer. Therefore, to investigate whether particular chemotherapeutic agents have a propensity to induce specific molecular subtypes of t-AML, it is of interest to study patients exposed to topoisomerase II targeting drugs used in the treatment of nonmalignant conditions, such as mitoxantrone in the management of multiple sclerosis (MS). MS is a putative autoimmune disease affecting the central

Submitted October 3, 2007; accepted July 5, 2008. Prepublished online as Blood First Edition paper, July 23, 2008; DOI 10.1182/blood-2007-10-115600.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked ‘‘advertisement’’ in accordance with 18 USC section 1734.

*S.K.H. and A.N.M. contributed equally to the experimental analyses and should be considered joint first authors.

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

3383

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. 3384

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

HASAN et al

nervous system for which mitoxantrone represents the latest in a long list of general immunosuppressive agents used in the treatment of this condition.10,11 In recent years, an increasing number of APL cases have been reported in MS patients treated with mitoxantrone.3,5,12-20 However, to date, no attempts have been made to systematically characterize translocation breakpoints in APL cases that developed in this setting. In the present study, we analyzed at the genomic level the PML and RARA breakpoints of 14 patients who developed APL on a background of MS, including 12 who received mitoxantrone for their primary disease. Furthermore, we used functional cleavage assays to better elucidate the mechanisms underlying the formation of the t(15;17) in this setting.

Methods Patients and samples The main patient characteristics, including demographic data, MS type, and treatments received for MS, are reported in Table 1. Seven patients were diagnosed in 5 Italian institutions, 3 in 2 Spanish institutions, 3 in the United Kingdom, and the remaining patient in Austria. Analyses were undertaken after informed patient consent was obtained in accordance with the Declaration of Helsinki with ethical approval of University Tor Vergata of Rome and St Thomas’ Hospital of London. Bone marrow samples were obtained at the time of diagnosis of APL. Mononuclear cells were collected after centrifugation on a Ficoll-Hypaque gradient and stored at ⫺70°C as dry pellets. In all cases, APL diagnosis was confirmed at the genetic level by reverse-transcriptase polymerase chain reaction (RT-PCR) amplification of the PML-RARA hybrid gene. Amplification of DNA spanning possible break points (PML-RARA): long-range PCR and DNA sequencing To determine the exact chromosomal breakpoint position in PML and RARA genes, genomic DNA extracted from APL blasts collected at diagnosis was amplified by a 2-step, long-range nested PCR method as reported elsewhere.5,21 Two forward and 8 reverse primers were designed for each step to cover the PML breakpoint region (bcr1 or bcr3, as previously known based on diagnostic RT-PCR results available for all cases) and the 16.9-kb-long RARA intron 2. PCR products were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). Samples were loaded in 96-well plates and covered with mineral oil. The amplified products were separated with a capillary electrophoresis-based system (CEQ 8000 Genetic Analysis System; Beckman Coulter, Fullerton, CA) using the “LFR1 Test” default run method and sequenced using appropriate primers.5,21 Rigorous procedures were used to reduce risk of PCR contamination,22 and genomic breakpoints were in all cases confirmed by PCR analysis of a fresh aliquot of DNA. Moreover, in 3 cases, breakpoint analyses were performed independently in parallel in the Rome and London laboratories, yielding identical results. Amplification and sequence analysis of the reciprocal RARA-PML genomic breakpoint junction Genomic RARA-PML was amplified using patient specific primers (designed on the basis of PML and RARA breakpoints) and fresh aliquots of DNA. In 13 cases, the reciprocal RARA-PML genomic breakpoint junction was sequenced, providing further confirmation of the t(15;17) translocation breakpoints at the genomic level. In one case (unique patient number [UPN] 10), no DNA was available to carry out sequencing of the reciprocal RARA-PML. Alignment of sequenced nucleotides using BLAST algorithm The patients’ genomic PML-RARA junction sequences were aligned against normal PML (GenBank accession number S57791 for bcr1 and S51489 for bcr3) and RARA intron 2 (GenBank accession number AJ297538) nucleo-

tides as a reference text input in BLAST/alignment program. The purpose of alignment was to identify any microhomologies between PML and RARA in the vicinity of the breakpoint.23 In vitro DNA cleavage assays Human topoisomerase II␣ was expressed in Saccharomyces cerevisiae24 and purified as described previously.25,26 Assays were performed as described previously.5 Briefly, having identified genomic junction sequences, regions of the normal homologs encompassing the breakpoint sites were amplified by PCR and subcloned into the pBluescript SKII(⫹) vector. The optimal insert size for the assay was 200 to 500 bp, with the breakpoint site located approximately 50 to 100 bp from the 5⬘ end of the insert. Substrates containing 25 ng of the normal homologs of the translocation breakpoints were 5⬘end-labeled (30 000 cpm) and incubated with 147 nM of human DNA topoisomerase II␣, 1 mM of ATP in the presence or absence of 20 ␮M mitoxantrone.5 In all cases, additional reactions were carried out to evaluate the heat stability of the covalent complexes formed. Cleavage complexes were irreversibly trapped by the addition of sodium dodecyl sulfate, and purified products were resolved in an 8% polyacrylamide-7.0 M of urea gel in parallel with dideoxy sequencing reactions primed at the same 5⬘-end, visualized by autoradiography, and quantified using PhosphoImager and IMAGEQUANT software (GE Healthcare, Little Chalfont, United Kingdom).

Results Clinical features

As shown in Table 1, a total of 14 patients with APL developing in a background of MS were studied. The series included 12 cases exposed to a median total dose of 105 mg mitoxantrone (range, 30-234 mg), whereas 2 patients received other treatments for their primary disease (interferon-␤ in UPN 10 and corticosteroids in UPN 12). The median latency period between the first exposure to mitoxantrone and APL diagnosis was 28 months (range, 460 months). Patients were treated with all-trans retinoic acid and anthracycline-based chemotherapy, mostly using AIDA-like (alltrans retinoic acid ⫹ idarubicin) protocols27 (Table 2); however, UPN 13 died of cerebral hemorrhage within 3 hours of APL diagnosis before antileukemic therapy was started. The remaining 13 patients achieved hematologic and molecular remission. Of these, 11 remain in first molecular remission at a median follow-up of 10 months, whereas UPN 7 relapsed at 28 months and achieved second molecular remission after salvage therapy with arsenic trioxide, and UPN 1 died of cerebral hemorrhage while in remission after 7 months. Location of t(15;17) translocation breakpoints within the PML and RARA loci

RT-PCR showed the bcr1 PML-RARA isoform (PML intron 6 breakpoint) in 12 cases, whereas in the remaining 2 cases the PML breakpoint fell within intron 3 (bcr3; Figure 1). This breakpoint distribution appeared skewed in favor of the bcr1 isoform, which previously has been reported to account for approximately 55% of unselected APL cases.28-30 Comparison of the breakpoint distribution in MS patients with mitoxantrone-related APL relative to a cohort of 1022 consecutive cases of newly diagnosed de novo APL from GIMEMA, PETHEMA, and United Kingdom MRC trials confirmed significant overrepresentation of involvement of PML intron 6 in the former group (11 of 12, 92% vs 622 of 1022, 61%: P ⫽ .035 by Fisher exact test). PML genomic breakpoints within intron 6 were found to fall between nucleotide positions 1482 and 1489 in 6 patients (UPNs 3, 6, 11, 12, 13, and 14; Figure 1A),

Patient no.

UPN 1

UPN 2

UPN 3

UPN 4

UPN 5

UPN 6

UPN 7

UPN 8

UPN 9

UPN 10

UPN 11

UPN 12

UPN 13

UPN 14

Sex

SPMS

PPMS

RRMS

PPMS

SPMS

RRMS

PPMS

SPMS

Primary disease

Mitoxantrone

Prednisone

Mitoxantrone

INF beta

Mitoxantrone

Type of treatment

70 147 170 234

10 mg/m2 every 3 mo 12 mg/m2 every 2 mo 12 mg/m2 every 2 mo 10 mg/m2 (every 1 mo, 3 doses), 10 mg/m2

120

8 mg/m2 every 1 mo 11.36 mg/m2 every 1 mo

13 mg monthly (5 doses)

237

120

216

12035-38

1483-86

11569-71 12038-39

1488-89

1486-88

14117 11569-71

1485-87

1485

11683-84 14785-87

1486-1506 1489-91

11586-89

1483-86

14920-25

15386-87

1286-87 1117-22†

15386-87

1286-87

675-76 30

1429-30 144

176

7978

10 mg/m2 every 2 mo

718-19

7974

12908-09

1409-10

204

1165

1484-85

12909-10

14054-55 1483-84

14082-83 1169-70

12418-19 1150-51

1922-23

15266-68 12418-19

1922-23

15266-68 1485-87

14446-49 1485-87

1657-60

6104-05 14446-49

1657-60

6104-05 1496-97

RARA* breakpoint der(15)-der(17)

1496-97

PML* breakpoint der(15)-der(17)

100

Bcr subtype

1.9 mg/m2 every 1 mo

Latency between mitoxantrone and APL, mo

1161

150

192

Latency between MS and APL, mo

(every 3 mo, 5 doses)

12 mg/m2 (every 1 mo, 3 doses), 6 mg/m2 110

10 mg/m2 every 2 mo

(every 3 mo, 7 doses)

Total dose, mg

10 mg/m2 every 1 mo

Mitoxantrone schedule

Therapy of MS

UPN indicates unique patient number (some details regarding UPNs 1, 4 and 5, and 7 were reported in references 20, 17, and 5, respectively); RRMS, relapsing-remitting multiple sclerosis; SPMS, secondary progressive multiple sclerosis; PPMS, primary progressive multiple sclerosis; and NA, not applicable. *Breakpoint locations are numbered according to the following GenBank accession numbers: PML intron 6 (bcr 1), S57791; PML intron 3 (bcr 3), S51489; and RARA intron 2, AJ297538. †No DNA was available to sequence the reciprocal RARA-PML in this case.

Age (y) at time of MS diagnosis

Table 1. Main clinical and molecular features of 14 sAPL patients

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. APL IN MULTIPLE SCLEROSIS 3385

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. 3386

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

HASAN et al

Table 2. Main clinical features and treatment outcome of sAPL patients APL characteristics Age (y) at time of APL diagnosis

Sex

WBC, ⴛ109/L

UPN 1

5.5

Yes

PETHEMA APL 2005

UPN 2

8.9

Yes

GIMEMA AIDA protocol

CCR 21 mo

UPN 3

0.5

PETHEMA APL 2005

CCR 16 mo

UPN 4

0.8

GIMEMA AIDA protocol

CCR 16 mo

UPN 5

1.1

Yes

GIMEMA AIDA protocol

CCR 24 mo

UPN 6

1.1

Yes

GIMEMA AIDA protocol

CCR 19 mo

UPN 7

0.7

UK MRC protocol

Relapse at 28 mo

UPN 8

3.3

PETHEMA APL 2005

CCR 4 mo

UPN 9

GIMEMA AIDA protocol

CCR 4 mo

UPN 10

33.7

Yes

GIMEMA AIDA protocol

CCR 10 mo

UPN 11

0.6

GIMEMA AIDA protocol

CCR 10 mo

UPN 12

1.1

PETHEMA APL 2005

CCR 9 mo

UPN 13

8.9

Yes

Died 3 h after APL diagnosis

UPN 14

72.2

Yes

PETHEMA APL 2005

CCR 1 mo

Patient no.

PLT, ⴛ109/L

Therapy of APL

DIC, Yes/No

Outcome Died at 7 months due to cerebral hemorrhage

DIC indicates disseminated intravascular coagulation; CCR, continuous complete remission; and NA, not applicable.

coinciding precisely with the “hotspot” previously identified in t-APL after mitoxantrone treatment for breast cancer.5 Interestingly, one of these patients (UPN 12) had not received mitoxantrone therapy for MS. In the 2 patients (UPNs 9 and 10) with the bcr3 PML-RARA isoform, the breakpoints in PML intron 3 were detected between nucleotides 1286 and 1287 and 1117 through 1122, respectively (Figure 1A). The breakpoints within the RARA locus were distributed across intron 2 without particular clustering in any restricted small region (Figure 1B). However, one breakpoint (in UPN 2) mapped precisely to a breakpoint found in a case of t-APL arising after mitoxantrone therapy for breast cancer, studied previously by Mistry et al.5

Sequence analyses of the reciprocal RARA-PML fusion revealed a balanced translocation in 7 of 13 analyzed cases. Six patients showed size variable deletions and/or insertions at the breakpoint junction (Table 1). Microhomologies at the breakpoint junctions were indicative of DNA repair by the nonhomologous end-joining (NHEJ) pathway.5 t(15,17) translocation breakpoints are preferential sites for mitoxantrone-induced DNA cleavage by human topoisomerase II␣

To investigate the mechanisms by which the t(15;17) chromosomal translocation may have been formed in MS patients treated with

Figure 1. Characterization of t(15;17) breakpoints within the PML and RARA loci. The location of breakpoints indicated by in the 14 patients (numbers correspond with UPNs in Tables 1 and 2) within the PML gene on chromosome 15 (A; bcr3 region and bcr1/2 region) and intron 2 of RARA on chromosome 17 (B) are shown. Breakpoint locations are numbered according to the following GenBank accession numbers: PML intron 6 (bcr 1), S57791; PML intron 3 (bcr 3), S51489; and RARA intron 2, AJ297538.23

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

APL IN MULTIPLE SCLEROSIS

3387

Figure 2. Investigation of t(15;17) translocation mechanism in UPN 2 by in vitro topoisomerase II␣ DNA cleavage assay. Chromosomal breakpoint junctions were examined in an in vitro topoisomerase II␣ cleavage assay using substrates containing PML (A) and RARA (B) translocation breakpoints in the APL case of UPN 2. Reactions in lane 1 were performed without DNA topoisomerase II␣ and lanes 2 to 5 show dideoxy sequencing reactions. DNA cleavage reactions were performed in the presence of 147 nM of human DNA topoisomerase II alpha and in the absence (lanes 6 and 8) or presence of 20 ␮M mitoxantrone (lanes 7 and 9). Reactions in lanes 8 and 9 were incubated at 75°C to assess the heat stability of the cleavage products seen in lanes 6 and 7. In each case, the location of the relevant heat stable cleavage site is indicated by an arrow on the far right. (C) Native PML and RARA sequences are shown in red and blue, respectively. In the creation of the PML-RARA genomic fusion, processing includes exonucleolytic deletion to form a 2-base homologous overhang that facilitates repair via the error prone NHEJ pathway. In the creation of the reciprocal RARA-PML genomic fusion, 2-base homologies facilitate NHEJ repair, whereas in both instances polymerization of the relevant overhangs fills in any remaining gaps (shown black font).

mitoxantrone, we evaluated topoisomerase II␣–mediated cleavage of the normal homologs of PML and RARA encompassing the respective breakpoints detected in 4 cases (UPNs 2, 7, 8, and 14) in the presence or absence of this agent. These included cases (ie, UPN 2 and UPN 14) in which the genomic breakpoint in the RARA or PML locus coincided with those reported previously in cases of t-APL arising in breast cancer patients treated with multiple DNA-damaging agents, including mitoxantrone.5 Few cleavage sites were observed in the absence of drug; however, bands of various sizes and intensities were observed in the presence of mitoxantrone in a topoisomerase II␣-dependent manner (Figures 2, 3 top panels). Cleavage bands that were significantly enhanced by mitoxantrone corresponding to the location of the observed genomic breakpoints in the PML and RARA loci were detected in each of the cases analyzed (Figures 2A,B, 3A,B; and data not shown). These bands remained detectable after heating, indicating stability of the cleavage complexes. In UPN 2, the case in which the RARA breakpoint was shared with a t-APL case that arose after mitoxantrone-containing breast cancer therapy,5 a functional site of mitoxantrone-induced cleavage by topoisomerase II was identified at position 14 444 (Figure 2B). To provide further evidence that the region between positions 1482 and 1489 within PML intron 6 (which was involved in almost half the cases) is also a preferential site of mitoxantrone-induced DNA cleavage mediated by topoisomerase II␣, the reverse complement of the described PML substrate5 was used in the cleavage assay. A strong heat-stable cleavage band was detected in the

presence of mitoxantrone at position 1488, which corresponds to the described functional cleavage at position 1484 on the upper strand5 (Figure 3A,C). Given that the chromosome 15 breakpoint in UPN 12 (in which there was no history of mitoxantrone exposure) also fell within this “hotspot,” it is interesting to note that a weak cleavage band was apparent in the presence of topoisomerase II␣ in the absence of drug (Figure 3A lane 6). This finding suggests that the sequence may be a natural site of topoisomerase II␣–mediated cleavage that could be relevant to the etiology of APL in this case. Based on sequence analysis of PML-RARA and reciprocal RARA-PML genomic breakpoints, the location of functional topoisomerase II␣ cleavage sites in the vicinity of the breakpoints, and known mechanisms by which topoisomerase II induces doublestrand breaks in DNA31 and their subsequent repair,6 it was possible to generate models as to how the t(15;17) chromosomal translocation could have been formed in the studied cases (Figure 2,3C). Type II topoisomerases introduce staggered nicks in DNA creating 5⬘-overhangs. In the models, repair of the overhangs in PML and RARA entails exonucleolytic digestion, pairing of complementary bases, and joining of DNA free ends by the NHEJ pathway, with template-directed polymerization to fill in any gaps.

Discussion In this study on sAPL that developed after MS, we were able to identify a biased distribution of breakpoints in the PML gene that

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. 3388

HASAN et al

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

Figure 3. Investigation of t(15;17) translocation mechanism in UPN 14 by in vitro topoisomerase II␣ DNA cleavage assay. DNA cleavage assays are shown for PML (A) and RARA (B) genomic breakpoint regions. For the PML assay, the reverse complement of the substrate containing the “hotspot” region between 1482 and 1489 described by Mistry et al5 was used. Lanes 1 to 9 of each cleavage assay are described in the legend to Figure 2. (C) Native PML and RARA sequences are shown in red and blue, respectively. In the creation of PML-RARA, processing includes exonucleolytic deletion and repair via the NHEJ pathway. In the creation of RARA-PML, 2-base homologies facilitate repair via the NHEJ pathway, whereas in both instances polymerization of the relevant overhangs fills in any remaining gaps (shown in black font).

clustered in the same “hotspot” region previously identified in APL cases arising after treatment with mitoxantrone for breast cancer.5 In addition, we established in one patient who the breakpoint in RARA intron 2 at position 14446-49 coincided with a breakpoint identified by Mistry et al in 1 of 5 t-APL cases arising in breast cancer patients treated with the same agent.5 Given that intron 2 is almost 17 kb in length, such tight clustering of breakpoints between 2 different t-APL cases would be highly improbable to occur by chance. This observation strongly suggests that this is a preferential site of mitoxantrone-induced cleavage of DNA by topoisomerase II␣. The hypothesis is further supported by our functional in vitro data that show that this RARA site, together with the previously identified 8-bp “hotspot” region in PML intron 6, are preferential targets of mitoxantrone-induced DNA damage mediated by topoisomerase II␣. Interestingly, of the 6 patients found to have PML breakpoints involving the “hotspot” region, one (UPN 12) did not receive mitoxantrone. Although mitoxantrone may significantly increase the chances of inducing DNA damage at this site, it is conceivable that this region represents a preferential site of cleavage by the native topoisomerase II␣ and could in some instances act in concert with environmental or dietary agents that also target the enzyme.32-36 Accordingly, in the other case of sAPL that arose in the

absence of mitoxantrone exposure (UPN 10), the in vitro DNA cleavage assay also revealed sites of cleavage in the PML and RARA substrates with topoisomerase II alone, which corresponded to the observed breakpoints (data not shown). In some cases, the occurrence of short homologies of 1 or 2 nucleotides at the breakpoint region between the PML and RARA genes precluded precise assignment of the breakpoint within each respective gene. However, further investigation using the in vitro functional assays enabled the location of preferential sites of mitoxantrone-induced topoisomerase II␣–mediated DNA cleavage to be mapped. Taking into account the mechanisms by which type II topoisomerases induce double-strand DNA breaks31 and the processes mediating their repair, most probably involving the NHEJ pathway,5,30 it was possible to model the generation of the t(15;17) chromosomal translocation underlying the development of APL in these cases. Previous studies have established the presence of functional topoisomerase II cleavage sites at translocation breakpoints in MLL-associated t-AML, indicating that direct DNA damage coupled with aberrant repair by the NHEJ pathway is probably relevant to the formation of translocations that disrupt other genes that are commonly involved in t-AML.37-39 To the best of our knowledge, 20 cases of sAPL occurring in patients with MS have been reported to date,3,5,12-20 4 of which are

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

included in the present series (UPNs 1, 4, 5, and 7) [5, 17, 20]. However, this is the first study to systematically analyze such cases at the genomic level. The incidence of sAPL arising in MS patients treated with mitoxantrone is not firmly established, as no systematic analysis has been undertaken to address this issue and only case reports have been published. On reviewing the records of 2336 MS patients treated with mitoxantrone, Voltz et al40 described 5 cases of t-AML and 2 sAPL as a case report. Ghalie et al41 assembled the records of 1378 patients treated with mitoxantrone in 3 MS studies and reported 2 patients who developed t-AML with an observed incidence proportion of 0.15% (95% confidence interval, 0.00%-0.40%). In addition to the reported 20 cases of sAPL, 8 cases of t-AML (non-M3) arising after mitoxantrone treatment for MS have been described, with the majority showing balanced translocations in their leukemic cells.40,42-46 Therefore, although it appears that an excess of sAPL cases are observed in the MS setting, the reasons underlying this phenomenon remain unclear at present and warrant further basic and epidemiologic investigation. It is unknown, for example, whether factors other than mitoxantrone may play a role in sAPL development in the context of MS. Finally, it would be important to assess prospectively the true incidence of APL development in the MS setting (with or without mitoxantrone). Considering the risk of leukemia development and cardiac toxicity, the Therapeutics and Technology Subcommittee of the American Academy of Neurology recently has recommended that mitoxantrone be reserved for patients with progressive MS who have failed other therapies.47 In conclusion, this study lends further support to the presence of preferential sites of DNA damage induced by mitoxantrone within PML intron 6 and suggests the existence of a further “hotspot” at the distal end of RARA intron 2. The susceptibility of these regions of the PML and RARA loci to topoisomerase II␣–mediated cleavage by mitoxantrone may underlie the propensity to develop this particular subtype of AML after exposure to this agent. Further

APL IN MULTIPLE SCLEROSIS

3389

studies are warranted to investigate whether MS patients have a particular predisposition to the development of sAPL.

Acknowledgments The authors thank Dr M. Boggild for provision of clinical data, Jelena Jovanovic for performance of MRD analyses, and Mireia Camos for kindly providing the DNA from UPN 12. This work was supported by grants from Associazione Italiana per la Ricerca sul Cancro (F.L.C.) and Italian Ministry of Health (Progetto Integrato Oncologia), Leukemia Research Fund of Great Britain (A.N.M., D.G.), the National Institutes of Health (grant R01CA077683 to C.A.F.; and grant GM33944 to J.A.W.B., N.O.), and the Polish Ministry of Science and Education (grant PBZ KBN 107 P04 2004, to M.L.).

Authorship Contribution: S.K.H. and A.N.M. performed the experiments, analyzed the data, and contributed to the manuscript; T.O. and M.L. assisted in experimental design and performance of experiments; A. Ledda, G.L.N., C.S., C.C., E.B., L.M., E.M., J.C., G.S., A. Lennard, J.E., M.T.V., and W.R.S. contributed to the samples, clinical data, and interpretation of results; J.A.W.B. and N.O. supplied vital reagents; D.G., M.A.S., C.A.F., and S.A. analyzed the data, critically reviewed the manuscript, and amended the final report; and F.L.C. and D.G. designed the study, supervised the research, and wrote the manuscript. Conflict-of-interest disclosure: The authors declare no competing financial interests. Correspondence: Francesco Lo-Coco, Department of Biopathology, University Tor Vergata, Via Montpellier 1, 00133, Rome, Italy; e-mail: [emailprotected].

References 1. Pollicardo N, O’Brien S, Estey EH, et al. Secondary acute promyelocytic leukemia: characteristics and prognosis of 14 patients from a single institution. Leukemia. 1996;10:27-31. 2. Pulsoni A, Pagano L, Lo Coco F, et al. Clinicobiological features and outcome of acute promyelocytic leukemia occurring as a second tumor: the GIMEMA experience. Blood. 2002;100:19721976. 3. Beaumont M, Sanz M, Carli PM, et al. Therapy related acute promyelocytic leukemia. J Clin Oncol. 2003;21:2123-2137. 4. Pedersen-Bjergaard J, Christiansen DH, Desta F, Andersen MK. Alternative genetic pathways and cooperating genetic abnormalities in the pathogenesis of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia. 2006;20: 1943-1949. 5. Mistry AR, Felix CA, Whitmarsh RJ, et al. DNA topoisomerase II in therapy-related acute promyelocytic leukemia. N Engl J Med. 2005;352:15291538. 6. Burden DA, Osheroff N. Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme. Biochim Biophys Acta. 1998;400: 139-154. 7. Zhang Y, Rowley JD. Chromatin structural elements and chromosomal translocations in leukemia: DNA repair. 2006;5:1282-1297. 8. Rene B, Fermandjian S, Mauffret O. Does topoisomerase II specifically recognize and cleave hairpins, cruciforms and crossovers of DNA? Biochimie. 2007;89:508-515.

9. Azarova AM, Lyu YL, Lin C, et al. Roles of DNA topoisomerase II isozymes in chemotherapy and secondary malignancies. Proc Natl Acad Sci U S A. 2007;104:11014-11019. 10. Millefiorini E, Gasperini C, Pozzilli C, et al. Randomized placebo-controlled trial of mitoxantrone in relapsing-remitting multiple sclerosis: 24-month clinical and MRI outcome. J Neurol. 1997;244: 153-159. 11. Fox EJ. Management of worsening multiple sclerosis with mitoxantrone: a review. Clin Ther. 2006; 28:461-474. 12. Vicari AM, Ciceri F, Folli F, et al. Promyelocytic leukemia following mitoxantrone as single agent for the treatment of multiple sclerosis. Leukemia. 1998;12:441-442. 13. Cattaneo C, Almici C, Borlenghi E, Motta M, Rossi G. A case of acute promyelocytic leukaemia following mitoxantrone treatment of multiple sclerosis. Leukemia. 2003;17:985-986. 14. Delisse B, de Seze J, Mackowiak A, et al. Therapy related acute myeloblastic leukemia after mitoxantrone treatment in a patient with multiple sclerosis. Mult Scler. 2004;10:92. 15. Novoselac AV, Reddy S, Sanmugarajah J. Acute promyelocytic leukemia in a patient with multiple sclerosis following treatment with mitoxantrone. Leukemia. 2004;18:1561-1562. 16. Arruda WO, Montu´ MB, de Oliveira Mde S, Ramina R. Acute myeloid leukaemia induced by mitoxantrone: case report. Arq Neuropsiquiatr. 2005;63:327-329. 17. Ledda A, Caocci G, Spinicci G, Cocco E, Ma-

musa E, La Nasa G. Two new cases of acut promyelocytic leukemia following mitoxantrone treatment in patients with multiple sclerosis. Leukemia. 2006;20:2217-2218. 18. Sumrall A, Dreiling B. Therapy-related acute nonlymphoblastic leukemia following mitoxantrone therapy in a patient with multiple sclerosis. J Miss State Med Assoc. 2007;48:206-207. 19. Ramkumar B, Chadha MK, Barcos M, Sait SN, Heyman MR, Baer MR. Acute promyelocytic leukemia after mitoxantrone therapy for multiple sclerosis. Cancer Genet Cytogenet. 2008;182: 126-129. 20. Bosca I, Pascual AM, Casanova B Coret F, Sanz MA. Four new cases of therapy-related acute promyelocytic leukemia after mitoxantrone. Neurology. 2008;71:457-458. 21. Reiter A, Saussele S, Grimwade D, et al. Genomic anatomy of the specific reciprocal translocation t(15;17) in acute promyelocytic leukemia. Genes Chromosomes Cancer. 2003;36:175-188. 22. Flora R, Grimwade D Real-time quantitative RTPCR to detect fusion gene transcripts associated with AML. Methods Mol Med. 2004;91: 151-173. 23. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL. GenBank. Nucleic Acids Res. 2008;36:D25-30. 24. Worland ST, Wang JC. Inducible overexpression, purification, and active site mapping of DNA topoisomerase II from the yeast Saccharomyces cerevisiae. J Biol Chem. 1989;264:4412-4416. 25. Elsea SH, Hsiung Y, Nitiss JL, Osheroff N. A

From www.bloodjournal.org at TOR VERGATA on January 10, 2009. For personal use only. 3390

BLOOD, 15 OCTOBER 2008 䡠 VOLUME 112, NUMBER 8

HASAN et al

yeast type II topoisomerase selected for resistance to quinolones: mutation of histidine 1012 to tyrosine confers resistance to nonintercalative drugs but hypersensitivity to ellipticine. J Biol Chem. 1995;270:1913-1920. 26. Kingma PS, Greider CA, Osheroff N. Spontaneous DNA lesions poison human topoisomerase IIalpha and stimulate cleavage proximal to leukemic 11q23 chromosomal breakpoints. Biochemistry. 1997;36:5934-5939. 27. Mandelli F, Diverio D, Avvisati G, et al. Molecular remission in PML/RAR␣-positive acute promyelocytic leukemia by combined all-trans retinoic acid and idarubicin (AIDA) therapy. Blood. 1997;90: 1014-1021. 28. Fenaux P, Chomienne C. Biology and treatment of acute promyelocytic leukemia. Curr Opin Oncol. 1996;8:3-12.

dren’s Cancer Group. Cancer Causes Control. 1996;7:581-590. 33. Strick R, Strissel PL, Borgers S, Smith SL, Rowley JD. Dietary bioflavonoids induce cleavage in the MLL gene and may contribute to infant leukaemia. Proc Natl Acad Sci U S A. 2000;97: 4790-4795. 34. Felix CA, Kolaris CP, Osheroff N. Topoisomerase II and etiology of chromosomal translocations: DNA repair. 2006;5:1093-1108. 35. Bandele OJ, Osheroff N. Bioflavonoids as poisons of human topoisomerase II␣ and II␤. Biochemistry. 2007;46:6097-6108. 36. Bandele OJ, Osheroff N. (–)-Epigallocatechin gallate, a major constituent of green tea, poisons human type II topoisomerases. Chem Res Toxicol. 2008;21:936-943.

29. Kane JR, Head DR, Balazs L, et al. Molecular analysis of the PML/RAR alpha chimeric gene in pediatric acute promyelocytic leukemia. Leukemia. 1996;10:1296-1302.

37. Lovett BD, Strumberg D, Blair IA, et al. Etoposide metabolites enhance DNA topoisomerase II cleavage near leukemia-associated MLL translocation breakpoints. Biochemistry. 2001;40:11591170.

30. Slack JL, Arthur DC, Lawrence D, et al. Secondary cytogenetic changes in acute promyelocytic leukemia: prognostic importance in patients treated with chemotherapy alone and association with the intron 3 breakpoint of the PML gene. A Cancer and Leukemia Group B study. J Clin Oncol. 1997;15:1786-1795.

38. Lovett BD, Lo Nigro L, Rappaport EF, et al. Nearprecise interchromosomal recombination and functional DNA topoisomerase II cleavage sites at MLL and AF-4 genomic breakpoints in treatmentrelated acute lymphoblastic leukemia with t(4;11) translocation. Proc Natl Acad Sci U S A. 2001;98: 9802-9807.

31. Fortune JM, Osheroff N. Topoisomerase II as a target for anticancer drugs: when enzymes stop being nice. Prog Nucleic Acid Res Mol Biol. 2000; 64: 221-253.

39. Whitmarsh RJ, Saginario C, Zhuo Y, et al. Reciprocal DNA topoisomerase II cleavage events at 5⬘-TATTA-3⬘ sequences in MLL and AF-9 create homologous single-stranded overhangs that anneal to form der(11) and der(9) genomic breakpoint junctions in treatment-related AML without further processing. Oncogene. 2003;22:84488459.

32. Ross JA, Potter JD, Reaman GH, Pendergrass TW, Robison LL. Maternal exposure to potential inhibitors of DNA topoisomerase II and infant leukemia (United States): a report from the Chil-

40. Voltz R, Starck M, Zingler V, Strupp M, Kolb HJ. Mitoxantrone therapy in multiple sclerosis and acute leukaemia: a case report out of 644 treated patients. Mult Scler. 2004;10:472-474. 41. Ghalie RG, Mauch E, Edan G, et al. A study of therapy-related acute leukaemia after mitoxantrone therapy for multiple sclerosis. Mult Scler. 2002;8:441-445. 42. Edan G, Brochet B, Brassat D, Safety profile of mitoxantrone in a cohort of 802 multiple sclerosis patients [abstract]. Neurology. 2002;58(suppl 3): 168. 43. Brassat D, Recher C, Waubant E, et al. Therapyrelated acute myeloblastic leukemia after mitoxantrone treatment in a patient with MS. Neurology. 2002;59:954-955. 44. Heesen C, Bruegmann M, Gbdamosi J, Koch E, Monch A, Buhmann C. Therapy related acute myelogenous leukemia in a patient with multiple sclerosis treated by mitoxantrone. Mult Scler. 2003;9:213-214. 45. Goodkin D. Therapy-related leukemia in mitoxantrone treated patients. Mult Scler. 2003;9:426. 46. Tanasescu R, Debouverie M, Pitton S, Anxionnat R, Vespignani H. Acute myeloid leukemia induced by mitoxantrone in a multiple sclerosis patient. J Neurol. 2004;251:762-763. 47. Goodin DS, Arnason BG, Coyle PK, Frohman EM, Paty DW; Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology. The use of mitoxantrone (Novantrone) for the treatment of multiple sclerosis: report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology. Neurology. 2003;61:13321338.

Note: Additional text and figures related to this chapter which are not available to online version of the manuscript. Fig S1: Schematic diagram showing the strategy employed to identify t(15;17) genomic breakpoint junction locations. (A) PML is shown in green, RARA in red, and the locations of the nested primers used to perform long range nested PCR are indicated by the horizontal arrows. Vertical arrows indicate the regions in which breakpoints are most likely to occur. (B) An example of the chromatogram obtained revealing the breakpoint junction sequence.

Figure S2. Locations of t-APL breakpoints in multiple sclerosis patients exposed to mitoxantrone. Der(15) and der(17) genomic breakpoint junctions in 3 cases. Native PML sequences are in red and RARA in blue. Vertical lines indicate sequences from the derivative chromosomes, and horizontal lines indicate regions of microhomologies consistent with DNA repair of chromosomal breaks by the non-homologous end joining pathway. Homologies prevented determining precise localization of breakpoint positions (black font).

TableS1: PML and RARA homologues provided the substrate for in vitro topoisomerase II cleavage assays

Figure S3: Investigation of t(15;17) translocation mechanism in UPN 7 by in vitro topoisomerase IIα DNA cleavage assay. Cleavage results of PML (A) and RARA (B) translocation breakpoints in the t-APL case of UPN 7. Lanes 1-9 of each cleavage assay are as previously described in the manuscript Figure 3. The location of the relevant heat stable cleavage sites are indicated by an arrow on the far right.

Figure S4. Investigation of translocation mechanism in UPN 8 by in vitro topoisomerase IIα DNA cleavage assay. Cleavage data using PML and RARA substrates corresponding to the locations of UPN 8 breakpoints previously identified. Lanes are as previously described, with relevant heat stable cleavage bands indicated by arrows on the far right.

Figure S5: The working model of DNA topoisomerase IIα cleavage assay. Normal homologues encompassing translocation breakpoint regions were end labelled, incubated with human DNA topoisomerase II, ATP, and mitoxantrone. Cleavage complexes were irreversibly trapped upon the addition of SDS (sodium dodecyl sulfate), purified, and resolved in a polyacrylamide gel alongside sequencing to map the sites of cleavage precisely, allowing analysis of the position of the cleavage sites with respect to translocation breakpoint sites. Levels of cleavage complexes are maintained in a critical balance. When levels drop below threshold concentrations, daughter chromosomes remain entangled following replication. As a result, chromosomes cannot segregate properly during mitosis and cells die as a result of catastrophic mitotic failure. When levels of cleavage complexes rise too high, cells also die, but for different reasons. Accumulated topoisomerase II–DNA cleavage intermediates are converted to permanent strand breaks when replication forks, transcription complexes or DNA tracking enzymes such as helicases attempt to traverse the covalently bound protein ‘roadblock’ in the genetic material . The resulting collision disrupts cleavage complexes and ultimately converts transient topoisomerase II-associated DNA breaks to permanent double-stranded breaks that are no longer tethered by proteinaceous bridges. The resulting damage and induction of recombination/repair pathways can trigger mutations, chromosomal translocations and other aberrations.

Chapter 3 Molecular analysis of the t(15;17) genomic breakpoints in epirubicin associated therapy-related APL following breast carcinoma

MYELOID NEOPLASIA

Brief report

Evidence for direct involvement of epirubicin in the formation of chromosomal translocations in t(15;17) therapy-related acute promyelocytic leukemia Ashley N. Mays,1 Neil Osheroff,2 Yuanyuan Xiao,3 Joseph L. Wiemels,3 Carolyn A. Felix,4 Jo Ann W. Byl,2 Kandeepan Saravanamuttu,5 Andrew Peniket,6 Robert Corser,7 Cherry Chang,8 Christine Hoyle,9 Anne N. Parker,10 Syed K. Hasan,11,12 Francesco Lo-Coco,11,12 Ellen Solomon,1 and David Grimwade1 1Department

of Medical & Molecular Genetics, King’s College London School of Medicine, London, United Kingdom; 2Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN; 3Department of Epidemiology and Biostatistics, University of California San Francisco; 4Department of Pediatrics, University of Pennsylvania, Division of Oncology, The Children’s Hospital of Philadelphia, PA; 5Department of Haematology, Lincoln County Hospital, Lincoln, United Kingdom; 6Department of Haematology, John Radcliffe Hospital, Oxford, United Kingdom; 7Department of Haematology, Queen Alexandra Hospital, Portsmouth, United Kingdom; 8Department of Haematology, Royal Derby Hospital, Derby, United Kingdom; 9Department of Haematology, Glan Clwyd Hospital, Rhyl, United Kingdom; 10The Beatson Institute, West of Scotland Cancer Centre, Glasgow, United Kingdom; 11Department of Biopathology, University of Tor Vergata, Rome, Italy; and 12Laboratorio di Neuro-Oncoematologia, Fondazione Santa Lucia, Rome, Italy

Therapy-related acute promyelocytic leukemia (t-APL) with t(15;17)(q22;q21) involving the PML and RARA genes is associated with exposure to agents targeting topoisomerase II (topoII), particularly mitoxantrone and epirubicin. We previously have shown that mitoxantrone preferentially induces topoII-mediated DNA damage in a “hotspot region” within PML intron 6. To investigate mechanisms un-

derlying epirubicin-associated t-APL, t(15; 17) genomic breakpoints were characterized in 6 cases with prior breast cancer. Significant breakpoint clustering was observed in PML and RARA loci (P ⴝ .009 and P ⴝ .017, respectively), with PML breakpoints lying outside the mitoxantrone-associated hotspot region. Recurrent breakpoints identified in the PML and RARA loci in epirubicin-related t-APL

were shown to be preferential sites of topoII-induced DNA damage, enhanced by epirubicin. Although site preferences for DNA damage differed between mitoxantrone and epirubicin, the observation that particular regions of the PML and RARA loci are susceptible to these agents may underlie their respective propensities to induce t-APL. (Blood. 2010;115: 326-330)

Introduction For many years it has been appreciated that exposure to drugs targeting topoisomerase II (topoII) predisposes to the development of secondary leukemias characterized by balanced translocations, particularly involving MLL at 11q23, NUP98 at 11p15, RUNX1 at 21q22, and RARA at 17q21.1-3 Indeed, therapy-related leukemias are becoming an increasing health care problem because more patients survive their primary tumors.3,4 TopoII is a critical enzyme that relaxes supercoiled DNA by transiently cleaving and religating both strands of the double helix by the formation of a covalent cleavage intermediate.5 Epipodophyllotoxins (eg, etoposide), anthracyclines (eg, epirubicin), and anthracenediones (eg, mitoxantrone) act as topoII poisons, inducing DNA damage by disrupting the cleavage-religation equilibrium and increasing the concentration of DNA topoII covalent complexes.5 The association between exposure to chemotherapeutic agents targeting topoII and development of leukemias with balanced chromosomal rearrangements has naturally implicated the enzyme in this process, but the mechanisms involved have remained subject to debate. Interestingly, the nature of the drug exposure has a bearing on the molecular phenotype of the resultant secondary leukemia, with translocations involving

11q23 being particularly associated with etoposide exposure,6,7 and development of therapy-related acute promyelocytic leukemia (t-APL) with the t(15;17) being linked to mitoxantrone and epirubicin treatment.8-11 Previously, we identified that t-APL cases arising in patients with breast cancer receiving mitoxantrone display tight clustering of chromosome 15 breakpoints within an 8 base pair (bp) “hotspot” region in PML intron 6.12 Furthermore, these breakpoints were shown by functional assay to be a preferred site of mitoxantrone-induced DNA topoII cleavage.12 Subsequent analysis of an independent cohort of t-APL cases arising after mitoxantrone therapy for multiple sclerosis confirmed chromosome 15 breakpoint clustering in the hotspot and identified recurrent breakpoints within RARA intron 2.13 Once again, these breakpoints were preferential sites of mitoxantrone-induced cleavage in vitro.13 No studies to date have investigated epirubicin-induced leukemias. This agent is widely used in adjuvant breast cancer therapy, with cumulative doses of 720 mg/m2 or less associated with a secondary leukemia risk of 0.37% at 8 years.14 Several balanced rearrangements have been reported in this context, including translocations involving the MLL locus, core binding factor leukemias, and t-APL with the t(15;17).14,15 To gain further

Submitted July 28, 2009; accepted October 1, 2009. Prepublished online as Blood First Edition paper, November 2, 2009; DOI 10.1182/blood-2009-07235051.

The online version of this article contains a data supplement.

Presented in part as an oral presentation at the 50th Annual Meeting of the American Society of Hematology, San Francisco, CA, December 9, 2008.

326

BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2

UPN2

UPN3

UPN4

UPN5

UPN6

Breastcarcinoma

Primary malignancy

990 mg)

955-57†

1968㛳

1184-85†

379-80§

955-59†

1964-65㛳

1191†

1187-

375-76§

14882-84

16196

13332-33

9291-92

16192

14884-88

16192-93

13336-40

9293-94

16192

13437

der(17)

APL therapy

PETHEMA‡ #1

MRC‡

PETHEMA‡

MRC‡

PETHEMA‡

1000 mg ⫻ 3) DXT

cyclophosphamide

epirubicin 100 mg,

1100 mg ⫻ 3; 5FU 1000 mg,

consolidation

t(15;17)(q22;q21)

der(12), t(8;12)(q13;p13),

t(15;17)(q22;q21)

1267§

13463

der(15)

cyclophosphamide

1270§

1185†

der(17)

RARA breakpoint¶

ATO ⫹ ATRA

300

360

400

450

t(15;17)(q22;q21)

t(7;14)(q32;q22),

1186†

der(15)

PML breakpoint

epirubicin 110 mg,

6 Cycles of FEC (5FU 1100 mg,

DXT

cyclophosphamide 980 mg),

epirubicin 98 mg,

6 Cycles of FEC (5FU 975 mg,

80 mg, 5FU 1200 mg) DXT

1200 mg, methotrexate

(cyclophosphamide

4 cycles of CMF

4 Cycles of epirubicin (200 mg),

(940 mg) DXT

⫹ cyclophosphamide

6 Cycles of epirubicin (118 mg)

(1180 mg) DXT

⫹ cyclophosphamide

4 Cycles of epirubicin (175 mg) 28

del(5)(q?31q?35)

methotrexate 65 mg, 5FU 400

Cytogenetics t(15;17)(q22;q12-21) idem,

(cyclophosphamide 990 mg,

400

Latency, mo*

6 cycles of CMF

4 Cycles of epirubicin (165 mg),

Treatment of primary malignancy

Cumulative dose of epirubicin, mg/m2

Current status of APL

Alive in first CRm at 15 mo

at 13 da

Induction death (typhlitis)

Alive in first CRm at 42 mo

infection) at 5 mo

Death in first CRm (fungal

30%–40%)

(ejection fraction

cardiomyopathy

by anthracycline-related

treatment complicated

Alive in first CRm at 43 mo;

Alive in first CRm at 61 mo

APL indicates acute promyelocytic leukemia; CRm, molecular remission; DXT, radiotherapy; 5FU, fluorouracil; UPN: Unique patient number; and #1, course 1. *Length of time between first epirubicin exposure and presentation with therapy-related APL. †Breakpoint locations for PML intron 6 are numbered according to the GenBank accession no. S57791. ‡Patients were treated with an extended course of all-trans retinoic acid (ATRA) given simultaneously with induction chemotherapy. Medical Research Council (MRC) and PETHEMA treatment schedules were given as described.16 UPN6 received consolidation with arsenic trioxide (ATO) and ATRA according to the National Cancer Research Institute AML17 protocol (http://aml17.cardiff.ac.uk). §Breakpoint locations for PML intron 3 are numbered according to the GenBank accession no. S51489. 㛳Breakpoint locations for PML exon 7 are numbered according to the GenBank accession no. S57791. ¶Breakpoint locations for RARA intron 2 are numbered according to the GenBank accession no. AJ297538.

UPN1

Age at APL diagnosis, Patient y

Table 1. Patient characteristics

BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2 t(15;17) MECHANISM IN EPIRUBICIN-RELATED APL 327

328

MAYS ET AL

BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2

insights into molecular mechanisms underlying epirubicin-related leukemias, we characterized t(15;17) genomic breakpoint junction regions in t-APL after breast cancer therapy.

t(15;17) MECHANISM IN EPIRUBICIN-RELATED APL

329

Results and discussion Clinical features

Methods t(15;17) Genomic breakpoint characterization Samples from 6 patients with t-APL (Table 1) were received by the APL Reference Laboratory, Guy’s Hospital. The study including patient information sheets and consent forms was approved by St Thomas’ Hospital London Research Ethics Committee (ref 06/Q0702/140), and performed with informed consent in accordance with the Declaration of Helsinki. Reverse transcriptase–polymerase chain reaction (PCR) was used to establish PML breakpoint region.16 Genomic breakpoint junction regions were then amplified with appropriate primer sets by nested long-range PCR, followed by sequence analysis, as described.17 PML-RARA breakpoint junctions were confirmed by PCR amplification and sequence analysis with the use of fresh aliquots of genomic DNA. Patient-specific primers were designed to PCR amplify and sequence the reciprocal RARA-PML genomic breakpoint junction regions. The distribution of genomic breakpoints was analyzed by scan statistics, as previously described.12,17 In vitro topoII DNA cleavage assays Normal homologues of PML and RARA encompassing the location of the relevant breakpoint were cloned into the pBluescript SKII (⫹) vector. Cleavage assays were performed as reported previously12,13 and included epirubicin, dissolved in 20 ␮L of DMSO used at a concentration of 160␮M.

Figure 1. Molecular characterization of the t(15;17) in therapy-related APL arising after epirubicin therapy. (A) Distribution of translocation breakpoints within the PML and RARA loci in t-APL cases arising after epirubicin and mitoxantrone. PML exons are represented by red boxes, RARA exons are in blue, and introns are represented by black lines. Arrows indicate the location of PML and RARA translocation breakpoints identified in patients with t-APL arising after mitoxantrone (red arrows) or epirubicin (green arrows), and numbers of the epirubicin-related cases correspond to those presented in Table 1. Details of the mitoxantrone cases have been reported previously.12,13 (B) PML and RARA breakpoints in epirubicinrelated t-APL are preferred sites of epirubicin-induced topoII-mediated DNA cleavage. To identify epirubicin-enhanced cleavage by topoII␣, chromosomal breakpoint junctions were examined in an in vitro assay. DNA cleavage reactions were performed with 25 ng of 5⬘-labeled DNA (30 000 cpm), 1mM ATP, DMSO, and in the presence or absence of 147nM human DNA topoII␣ and 160␮M epirubicin. Cleavage complexes were trapped on the addition of SDS and were resolved in an 8% acrylamide–7.0M urea gel. In both panels, reactions in lane 1 were performed with epirubicin (Epi) but lacking DNA topoII␣ and show little evidence of cleavage in the absence of the enzyme. Lanes 2 to 5 show dideoxy sequencing reactions primed at the same 5⬘ end, which allows high-resolution mapping of cleavage sites. Substrates were incubated with topoII␣ and DMSO only (lanes 6 and 8) and also in the presence of epirubicin (lanes 7 and 9). Reactions in lanes 8 and 9 were further incubated at 75°C to assess the heat stability of the cleavage complexes. On the left, DNA topoII␣-dependent cleavage is shown within a PML substrate that encompassed the locations of the genomic breakpoints identified in UPN1 and UPN4. The location of the arrows indicate the epirubicin-enhanced heat-stable complexes at position 1184, corresponding precisely to these translocation breakpoints. On the right, cleavage within a substrate that contains the normal homologue of RARA encompassing the breakpoint junction identified in UPN4 is shown, whereby the arrows indicate the epirubicin-enhanced heat-stable complexes corresponding to the der(15) and der(17) translocation breakpoints. (C) Model for formation of the t(15;17) underlying epirubicininduced t-APL in UPN4. Normal homologues of PML and RARA are indicated in red and blue fonts, respectively. Models show where topoII␣ introduces 4-bp staggered nicks in the DNA (as indicated by in vitro experiments), followed by exonucleolytic processing to reveal microhomologies (indicated by gray boxes) that are probably repaired by the error-prone nonhomologous end joining repair pathway. Templatedirected polymerization (indicated with black font), mismatch repair (represented by green font), and ligation fills in any remaining gaps to generate the PML-RARA and RARA-PML genomic breakpoint junctions that were identified in the t-APL arising in this patient.

Demographic features and details of the treatment received by the 6 patients with t-APL for their original breast cancer are shown in Table 1. Median latency from time of first epirubicin exposure to t-APL diagnosis was 26 months (range, 18-48 months). Identification of t(15;17) genomic translocation breakpoints

Chromosome 15 breakpoints were localized to PML intron 6 (UPN1, UPN4, UPN6), intron 3 (UPN2, UPN3), and exon 7 (UPN5), with breakpoints in 2 of the cases (UPN1, UPN4) found to fall within 1 to 2 bp of one another (Table 1). Given the size of PML intron 6 (⬃ 1 kb), the close apposition of these breakpoints was unlikely to have occurred by chance (P ⫽ .014 using scan statistics for the 1056-bp intron 6 only with 3 patients; P ⫽ .009 for the 3921-bp exon 5-7b region and 4 patients). The chromosome 17 breakpoints of the 6 cases were distributed within RARA intron 2, with breakpoints in 2 patients (UPN2, UPN5) falling within 4 nucleotides of one another between positions 16192 and 16196. Considering the length of this intron (⬃ 17 kb), the proximity of the breakpoints in these 2 patients was also unlikely to have occurred by chance (P ⫽ .017 for the 16913-bp intron). The breakpoint locations within the PML locus of the epirubicin-related t-APL cases occurred outside the hotspot region in intron 6 (1482-9) previously mapped in cases occurring after mitoxantrone treatment for breast cancer12 or multiple sclerosis13 (Figure 1A). t(15;17) Translocation breakpoints are preferential sites for epirubicin-induced DNA cleavage by topoII

To investigate mechanisms by which the t(15;17) may have been formed after epirubicin exposure, we evaluated topoII␣-mediated cleavage of the normal homologues of PML and RARA encompassing the respective breakpoints detected in 4 cases in the presence or absence of this agent, including those in which the PML (UPN1, UPN4) or RARA breakpoints (UPN2, UPN5) were closely apposed. Some DNA cleavage bands were observed in the absence of drug, but the addition of epirubicin increased DNA cleavage in a topoII-dependent manner (Figure 1B). Cleavage bands that were significantly enhanced by epirubicin corresponding to the location of the observed genomic breakpoints in the PML and RARA loci were detected in each of the cases analyzed (Figure 1B; supplemental Figure 1, available on the Blood website; see the Supplemental Materials link at the top of the online article). These bands remained detectable after heating at 75°C, indicating stability of the cleavage complexes. The shared breakpoints in PML and RARA related to functional sites of epirubicin-induced cleavage by topoII at positions 1184 (Figure 1B) and 16192 (supplemental Figure 1A), respectively. On the basis of sequence analysis of PML-RARA and reciprocal RARA-PML genomic junction regions, the location of functional topoII cleavage sites in the vicinity of the breakpoints, and known mechanisms by which topoII induces double-strand breaks in DNA,5,18 it was possible to generate models as to how the t(15;17) chromosomal translocation could have been formed in the studied cases (Figure 1C; supplemental Figure 1B). Type II topoisomerases introduce staggered nicks in DNA, creating 5⬘-overhangs. In the models, repair of the overhangs in PML and RARA entails

330

BLOOD, 14 JANUARY 2010 䡠 VOLUME 115, NUMBER 2

MAYS ET AL

exonucleolytic digestion, pairing of complementary bases, and joining of DNA free ends by the nonhomologous end-joining pathway, with template-directed polymerization to fill in any gaps. Although there is strong circumstantial evidence linking exposure to agents targeting topoII to the development of leukemias with balanced chromosomal translocations, the precise mechanisms remain uncertain. One hypothesis takes into account reports that leukemia-associated translocations can be detected in hematopoietic cells derived from healthy persons without overt leukemia,19,20 suggesting that administration of chemotherapy provides a selective advantage to progenitors with preexisting translocations during regrowth of depopulated bone marrow. In this case, exposure to DNA-damaging agents is postulated to induce additional mutations that cooperate with the chimeric fusion protein to mediate leukemic transformation. A second hypothesis proposes that chromosomal translocations arise through an indirect mechanism involving induction of apoptotic nucleases.21-24 However, our studies involving the characterization of t-APL cases after mitoxantrone12,13 or epirubicin provide very strong support for a third hypothesis whereby topoII induces double-strand DNA breaks in susceptible regions of the genome which are aberrantly repaired to generate leukemia-associated chromosomal translocations.25

Acknowledgments We thank Jelena Jovanovic for RT-PCR analyses to define PMLRAR␣ isoform type and Glynis Lewis for provision of clinical data.

This work was supported by a Leukaemia Research Gordon Piller Studentship (A.N.M., D.G., and E.S.), and by the National Institutes of Health (grant CA077683, C.A.F.; and grant GM33944, N.O.). S.K.H. and F.L.-C. were supported by Associazione Italiana per la Ricerca sul Cancro (AIRC), the Progetto Integrato Oncologia of the Italian Ministry of Health. J.L.W. and Y.X. were supported by the Children with Leukaemia Fund UK.

Authorship Contribution: A.N.M. performed the experiments, analyzed the data, and wrote the manuscript; N.O. supplied vital reagents, analyzed the data, critically reviewed the manuscript, and amended the final report; Y.X. undertook statistical analyses; J.L.W. undertook statistical analyses, analyzed the data, critically reviewed the manuscript, and amended the final report; C.A.F. analyzed the data, critically reviewed the manuscript, and amended the final report; J.A.W.B. supplied vital reagents; K.S., A.P., R.C., C.C., C.H., and A.N.P. provided samples and clinical data and contributed to interpreting the results; S.K.H. assisted in performing the experiments, F.L.-C. and E.S. analyzed the data, critically reviewed the manuscript, and amended the final report; and D.G. designed the study, supervised the research, and wrote the manuscript. Conflict-of-interest disclosure: The authors declare no competing financial interests. Correspondence: David Grimwade, Department of Medical & Molecular Genetics, King’s College London School of Medicine, 8th Fl, Tower Wing, Guy’s Hospital, London SE1 9RT, United Kingdom; e-mail: [emailprotected].

References 1. Pedersen-Bjergaard J. Insights into leukemogenesis from therapy-related leukemia. N Engl J Med. 2005;352(15):1591-1594. 2. Larson RA, Le Beau MM. Therapy-related myeloid leukaemia: a model for leukemogenesis in humans. Chem Biol Interact. 2005;153-154:187195. 3. Allan JM, Travis LB. Mechanisms of therapy-related carcinogenesis. Nat Rev Cancer. 2005; 5(12):943-955. 4. Seedhouse C, Russell N. Advances in the understanding of susceptibility to treatment-related acute myeloid leukaemia. Br J Haematol. 2007; 137(6):513-529.

10. Andersen MK, Larson RA, Mauritzson N, et al. Balanced chromosome abnormalities inv(16) and t(15;17) in therapy-related myelodysplastic syndromes and acute leukemia: report from an international workshop. Genes Chromosomes Cancer. 2002;33(4):395-400. 11. Carli PM, Sgro C, Parchin-Geneste N, et al. Increase therapy-related leukemia secondary to breast cancer. Leukemia. 2000;14(6):1014-1017. 12. Mistry AR, Felix CA, Mason A, et al. DNA topoisomerase II in therapy-related acute promyelocytic leukemia. N Engl J Med. 2005;352(15): 1529-1538.

5. Deweese JE, Osheroff N. The DNA cleavage reaction of topoisomerase, II: wolf in sheep’s clothing. Nucleic Acids Res. 2009;37(3):738-748.

13. Hasan SK, Mays AN, Ottone T, et al. Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis. Blood. 2008; 112(8):3383-3390.

6. Bloomfield CD, Archer KJ, Mro´zek K, et al. 11q23 balanced chromosome aberrations in treatmentrelated myelodysplastic syndromes and acute leukemia: report from an international workshop. Genes Chromosomes Cancer. 2002;33(4):362378.

14. Praga C, Bergh J, Bliss J, et al. Risk of acute myeloid leukemia and myelodysplastic syndrome in trials of adjuvant epirubicin for early breast cancer: correlation with doses of epirubicin and cyclophosphamide. J Clin Oncol. 2005;23(18): 4179-4191.

7. Sung PA, Libura J, Richardson C. Etoposide and illegitimate DNA double-strand break repair in the generation of MLL translocations: new insights and new questions. DNA Repair (Amst). 2006; 5(9-10):1109-1118.

15. Pedersen-Bjergaard J, Sigsgaard TC, Nielsen D, et al. Acute monocytic or myelomonocytic leukemia with balanced chromosome translocations to band 11q23 after therapy with 4-epi-doxorubicin and cisplatin or cyclophosphamide for breast cancer. J Clin Oncol. 1992;10(9):1444-1451.

8. Beaumont M, Sanz M, Carli PM, et al. Therapyrelated acute promyelocytic leukemia. J Clin Oncol. 2003;21(11):2123-2137. 9. Pulsoni A, Pagano L, Lo Coco F, et al. Clinicobiological features and outcome of acute promyelocytic leukemia occurring as a second tumor: the GIMEMA experience. Blood. 2002;100(6):19721976.

16. Grimwade D, Jovanovic JV, Hills RK, et al. Prospective minimal residual disease monitoring to predict relapse of acute promyelocytic leukemia and to direct pre-emptive arsenic trioxide therapy. J Clin Oncol. 2009;27(22):3650-3658. 17. Reiter A, Saussele S, Grimwade D, et al. Genomic anatomy of the specific reciprocal trans-

location t(15;17) in acute promyelocytic leukemia. Genes Chromosomes Cancer. 2003;36(2):17588. 18. McClendon AK, Osheroff N. DNA topoisomerase II, genotoxicity, and cancer. Mutat Res. 2007; 623(1-2):83-97. 19. Mori H, Colman SM, Xiao Z, et al. Chromosome translocations and covert leukemic clones are generated during normal fetal development. Proc Natl Acad Sci U S A. 2002;99(12):8242-8247. 20. Basecke J, Cepek L, Mannhalter C, et al. Transcription of AML1/ETO in bone marrow and cord blood of individuals without acute myelogenous leukemia. Blood. 2002;100(6):2267-2268. 21. Stanulla M, Wang J, Chervinsky DS, Thandla S, Aplan PD. DNA cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher-order chromatin fragmentation during the initial stages of apoptosis. Mol Cell Biol. 1997;17(7):4070-4079. 22. Betti CJ, Villalobos MJ, Diaz MO, Vaughan AT. Apoptotic triggers initiate translocations within the MLL gene involving nonhomologous end joining repair system. Cancer Res. 2001;61(11):45504555. 23. Sim SP, Liu LF. Nucleolytic cleavage of the mixed lineage leukemia breakpoint cluster region during apoptosis. J Biol Chem. 2001;276(34):3159031595. 24. Betti CJ, Villalobos MJ, Diaz MO, Vaughan AT. Apoptotic stimuli initiate MLL-AF9 translocations that are transcribed in cells capable of division. Cancer Res. 2003;63(6):1377-1381. 25. Felix CA, Kolaris CP, Osheroff N. Topoisomerase II and the etiology of chromosomal translocations. DNA Repair (Amst). 2006;5(9-10):1093-1108.

Note: Additional text and figures related to this chapter which is not available online. Table S1: . Reported cases of t-leukemia after epirubicin exposure. Abbreviations: ALLacute lymphoblastic leukemia; AML- acute myeloid leukaemia

Reference (Campone et al., 2005)

(van der Hage et al., 2001) (Coombes et al., 1996) (Bernard-Marty et al., 2003)

Size of Number and Cohort/ % Subtype of tDeveloping Leukemia t-AL

Cytogenetics

Latency

2 ALL

t(9;22) Not specified

55 months 69 months

2 AML (M2)

t(9;22) t(8;21)

49 months 125 months

3 AML (M4)

t(8;16), del(17q21) del(16q) Not specified

8 months 81 months 58 months

698

1 AML (M3) 0

t(15;17) Not applicable

23 months Not applicable

380

Not applicable

522/ (0.5%)

2 AML (M5)

t(1;9;11)(q31q32;p21;q23) t(9;11)

21 months

2603/ (0.3%)

32 months

(Wils et al., 1999)

303/ (0.6%)

1 AML (M6) 2 AML (M4)

del(7q) Not specified

(Levine et al., 1998)

351/ (1.4%)

1 ALL

Not specified

57 months 18 months 58 months 15-41 months

636/ (1.3%)

4 AML (Not specified) 3 AML (M5)

11q23 (n=1) Not specified (n=3) Normal t(9;11) Not specified

14 months 15 months 15 months

2 AML (M4)

11q23 Normal

27 months 18 months

2 AML (Not specified)

Not specified complex

39 months 79 months

2 pre-B ALL

Not specified t(9;11) Not specified

24 months 14 months 9-33 months

(Crump et al., 2003)

(Bergh et al., 2000)

525/ (1.1%)

6 AML

Figure S1. Location of t-APL breakpoints in breast carcinoma patients exposed to epirubicin. Der(15) and der(17) genomic breakpoint locations are shown for six epirubicin exposed patients with PML sequences shown in red font, and RARA in blue. Vertical lines indicate sequence homology with derivative chromosomes while horizontal lines indicate microhomologies between the PML and RARA sequences.

Table S2. PML and RARA homologues used as substrates for in vitro assays.

Chapter 4 Analysis of t(15;17) chromosomal breakpoint sequences in therapy-related versus de novo APL

GENES, CHROMOSOMES & CANCER 00:000–000 (2010)

RESEARCH ARTICLE

Analysis of t(15;17) Chromosomal Breakpoint Sequences in Therapy-Related Versus De Novo Acute Promyelocytic Leukemia: Association of DNA Breaks with Specific DNA Motifs at PML and RARA Loci Syed Khizer Hasan,1,2* Tiziana Ottone,1,2 Richard F. Schlenk,3 Yuanyuan Xiao,4 Joseph L. Wiemels,4 Maria Enza Mitra,5 Paolo Bernasconi,6 Francesco Di Raimondo,7 Maria Teresa Lupo Stanghellini,8 Pepa Marco,9 Ashley N. Mays,10 Hartmut Do¨hner,3 Miguel A. Sanz,11 Sergio Amadori,1 David Grimwade,10 and Francesco Lo-Coco1,2* 1

Department of Biopathology,University of ‘RomeTor Vergata’, Rome,Italy Laboratorio di Neuro-Oncoematologia,Fondazione Santa Lucia,Rome,Italy 3 Department of Internal Medicine III,University Hospital of Ulm,Ulm,Germany 4 Department of Epidemiology and Biostatistics,University of California San Francisco, San Francisco,CA 5 Division of Hematology,University of Palermo,Palermo,Italy 6 Divison of Hematology,University of Pavia,Pavia,Italy 7 Division of Hematology,University of Catania,Catania,Italy 8 Department of Hematology, San Raffaele Scientif|c Institute,Milan,Italy 0 9 Servicio de Hematologl a,Hospital General de Castello¤n,Valencia, Spain 10 Department of Medical and Molecular Genetics,King’s College London School of Medicine,UK 11 Department of Hematology,University Hospital La Fe,Valencia, Spain 2

We compared genomic breakpoints at the PML and RARA loci in 23 patients with therapy-related acute promyelocytic leukemia (t-APL) and 25 de novo APL cases. Eighteen of 23 t-APL cases received the topoisomerase II poison mitoxantrone for their primary disorder. DNA breaks were clustered in a previously reported 8 bp ‘‘hot spot" region of PML corresponding to a preferred site of mitoxantrone-induced DNA topoisomerase II-mediated cleavage in 39% of t-APL occurring in patients exposed to this agent and in none of the cases arising de novo (P ¼ 0.007). As to RARA breakpoints, clustering in a 30 region of intron 2 (region B) was found in 65% of t-APL and 28% of de novo APL patients, respectively. Scan statistics revealed signiﬁcant clustering of RARA breakpoints in region B in t-APL cases (P ¼ 0.001) as compared to de novo APL (P ¼ 1). Furthermore, 300 bp downstream of RARA region B contained a sequence highly homologous to a topoisomerase II consensus sequence. Biased distribution of DNA breakpoints at both PML and RARA loci suggest the existence C 2010 Wiley-Liss, Inc. V of different pathogenetic mechanisms in t-APL as compared with de novo APL.

INTRODUCTION

In the acute promyelocytic leukemia (APL) speciﬁc t(15;17)(q22;q21) translocation, rearrangements between chromosome 15 and 17 are generated because of endogenous or exogenous DNA breaks at these loci. Chemotherapeutic drugs targeting topoisomerase II (topoII) produce exogenous DNA double strand breaks at the site of the enzyme-DNA complex and previous studies have implicated these agents in the pathogenesis of therapy-related APL (t-APL) (Beaumont et al., 2003; Mistry et al., 2005; Hasan et al., 2008). Therapy-related leukemias provide an extraordinary opportunity to investigate key mechanisms of leukemogenesis by relating speciﬁc genetic abnormalities to the biological effects of chemotherapeutic agents. We and others (Mistry et al., C 2010 Wiley-Liss, Inc. V

2005; Hasan et al., 2008) have shown that mitoxantrone-induced topoII mediated DNA damage at the PML and RARA breakpoint loci and their subsequent repair via the error prone nonhomologous end joining pathway lead to the formation of the t(15;17) in t-APL. Moreover, both studies Supported by: Associazione Italiana per la Ricerca sul Cancro (AIRC), Progetto Integrato Oncologia of the Italian Ministry of Health, Leukaemia and Lymphoma Research of Great Britain (Gordon Piller Studentship award), Children with Leukaemia Fund UK. *Correspondence to: Syed Khizer Hasan or Francesco Lo-Coco, Department of Biopathology, University Tor Vergata, Via Montpellier 1, 00133, Rome, Italy. E-mail: [emailprotected] or [emailprotected] Received 24 December 2009; Accepted 6 April 2010 DOI 10.1002/gcc.20783 Published online in Wiley InterScience (www.interscience.wiley.com).

Genes, Chromosomes & Cancer DOI 10.1002/gcc

8,375 8,760–8,762 12,853–12,856 14,585–14,586 15,462–15,463 15,583–15,584 16,613–16,616 1,075 1,483–1,485 142–145 1,682–1,683 1,941–1,942 1,487–1,488 299–302 1 1 3 1 1 1 3

61F 65F

29F 31F 36F 27M 19F 33M 48M

GE205 GE477

GE1 PAV PAL CTN GE723 MLN VLN

ABVD, adriamycin, bleomycin, vinblastine dacarbazine; NA, not applicable; MS, multiple sclerosis; APL, acute promyelocytic leukemia; mos, months.

95 39 195 14 NA 90 120 Mitoxantrone Mitoxantrone Interferon and Mitoxantrone Interferon and Mitoxantrone ABVD and Radiation Mitoxantrone Steroids and Mitoxantrone

10 mg/m2 every 2 month 13 mg/m2/month 24 mg/m2 every 3 month 14 mg/m2/month NA 10 mg/m2/month 10 mg/m2 every 3 month

29 36 135 25 33 86 180

2,146–2,147 7,096–7,098 1,169–1,170 1,274–1,276 1 1 14 69 NA NA NA NA Radiation and tamoxifen Radiation

Age/sex Patient ID

Twenty-three patients with t-APL and 25 patients with de novo APL were included in the study. The t-APL cases were collected from several European Hematology Units as part of a collaborative study on t-APL arising after mitoxantrone treatment for multiple sclerosis (MS). Molecular characterization of DNA breakpoints in 14 (UPN 1 to 14) of 23 patients with t-APL has been reported elsewhere (Hasan et al., 2008). The de novo APL cases were consecutively diagnosed and treated at the Department of Biopathology, Policlinico Tor Vergata in Rome between 2001 and 2009. The main clinico–biological features of 9 unreported tAPL cases are described in Table 1. In six of these

Primary disease

PATIENTS AND METHODS

Breast cancer Corpus uteri carcinoma Multiple sclerosis Multiple sclerosis Multiple sclerosis Multiple sclerosis Hodgkin lymphoma Multiple sclerosis Multiple sclerosis

PML breakpoints Bcr isoform Therapy

Mitoxantrone schedule

Mitoxantrone total dose (mg)

Interval between MS and APL (mos) TABLE 1. Clinical and Molecular Characteristics of 9 t-APL Cases

(Mistry et al., 2005; Hasan et al., 2008) have conﬁrmed a tight clustering of translocation breakpoints at the PML locus in mitoxantrone related t-APL. The proposed mechanisms mediating chromosomal rearrangements in de novo leukemias are diverse. Several studies on cloned genomic breakpoints from many patients with various translocations revealed speciﬁc DNA sequence motifs in the vicinity of the breakpoint junctions (Tsujimoto et al., 1985; Haluska et al., 1986; van der Reijden et al., 1999; Kolomietz et al., 2002; Abeysinghe et al., 2003) while other reports did not bring convincing evidence for conserved sequences at DNA breaks (Yoshida et al., 1995; Reichel et al., 1998; Zhang et al., 2006). However, the role of V-D-J recombinase has been shown in several de novo translocations where genes involved in fusion transcripts are nonIg-TCR loci but still contain recombination signal sequences (Tsujimoto et al., 1985; Haluska et al., 1986). A previous study on molecular analysis of t(15;17) in de novo APL (Yoshida et al., 1995) reported random DNA breaks at PML and RARA loci without any speciﬁc consensus sequence motif around them. By contrast, genomic analysis of PML and RARA loci from another study reported recombination prone sequences such as ALU elements and recombination signal sequences (RSS) at the 50 end of RARA intron 2 (Reiter et al., 2003). Here, we investigated PML and RARA DNA breakpoints in t-APL with or without prior exposure to topoII targeting agents and in APL arising de novo. The current study is also an attempt to correlate the speciﬁc DNA motifs with observed translocation breakpoints in a series of de novo APL patients.

RARA breakpoints

HASAN ET AL.

t(15;17) GENOMIC BREAKPOINTS IN DE NOVO AND t-APL

nine cases, t-APL developed after mitoxantrone treatment for MS whereas in the remaining three patients (GE205, GE477, and GE723) t-APL followed treatment for breast cancer, corpus uteri carcinoma, and Hodgkin’s lymphoma, respectively. RNA Extraction and cDNA Synthesis

Total RNA was extracted from leukemic blasts using Trizol and reverse transcribed according to the Roche diagnostics cDNA kit manual. PML-RARA isoforms were ampliﬁed by a reported RT-PCR based method (van Dongen et al., 1999). Genomic PML-RARA Speciﬁc PCR and Direct Sequencing

DNA was extracted from frozen bone marrow pelleted cells collected at the time of APL diagnosis, using the salting out protocol. On the basis of isoform type determined by RT-PCR, a longrange nested PCR strategy based on appropriate intronic regions of PML (intron 6 for bcr1 and intron 3 for bcr 3) and RARA (intron 2) genes was adopted to amplify the genomic PML-RARA fusion transcripts. To identify the exact location of PML and RARA breakpoints, ampliﬁed PCR products were sequenced. In brief, all puriﬁed amplicons were directly sequenced using the BigDyeV Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in conjunction with GeneAmp 9700 PCR Systems (Applied Biosystems). Each 10 ll sequencing reaction contained the following: 1 ll of BigDye v3.1(Applied Biosystems), 2 ll of BigDyeV Terminator v1.1/3.1 Sequencing Buffer (5), 1 ll of PCR primer (5 lM), 3 ng/200 bp of puriﬁed PCR product, and enough Gibco distilled water (Invitrogen, Grand Island, New York) to bring the total volume to 10 ll. Thermocycling parameters for PCR product sequencing were as follows: 10 at 96 C; 100 ’ at 96 C, 50 ’ at 50 C, and 40 at 60 C for 40 cycles. Sequencing reaction products were puriﬁed using the CentriSep columns (Applied Biosystems) according to the manufacturer’s recommendations. Samples were diluted with 16 ll of ABI HiDi Formamide (Applied Biosystems) and resolved on an ABI 3130 automated sequencer (Applied Biosystems). R

Identiﬁcation of Recombination Prone Sequences at PML and RARA Loci

ALU elements are rare within the human genome (Stenger et al., 2001) but are known to

be hotspots for genomic instability (Gebow et al., 2000; Lobachev et al., 2000; Stenger et al., 2001). A web based tool (http://transpogene.tau.ac.il/) was used for the identiﬁcation of ALU recombination sequences in the vicinity of the PML and RARA breakpoint regions. Computational analysis was further narrowed on the webpage by selecting all intronic transposable elements (TE) of human alone. The exclusion of other species in the TE selection criteria helps in unbiased interpretation of the data. V-D-J RSS in PML and RARA genes were searched for using the criteria described elsewhere (Gellert, 1992; Gu et al., 1992; van der Reijden et al., 1999). Statistical Method

The signiﬁcance of the cluster regions of RARA intron 2 in cases of t-APL or de novo APL was assessed with the use of scan statistics, which are based on the maximal number of events occurring in a prescribed interval. The statistic is deﬁned as follows. Let N(x, x þ d) be the number of breakpoints contained in the interval (x, x þ d). Then the scan statistic for the prescribed interval length d is Nd ¼ max N(x, x þ d), where the maximum is taken overall positions x such that the interval (x, x þ d) is within the intron. This statistic is then referenced against a uniform (null) distribution reﬂecting the absence of clustering. In the case of translocation breakpoint clustering in RARA intron 2, the event is the occurrence of a breakpoint, the interval is the number of base pairs spanning the putative cluster, and the reference interval is the intron length. To compute signiﬁcance of clustering, we used the accurate, end point-corrected, large deviation approximation to the one-dimensional scan statistic (Segal et al., 2002). RESULTS AND DISCUSSION

According to breakpoint sequencing data, we identiﬁed two potential breakpoint cluster regions in RARA intron 2 (GenBank accession number AJ297538), i.e., one at the 50 proximal end (Chr17: region A, 6,000–9,800; 3.8 kb) and the other one at the 30 distal end (region B, 11,500– 15,600; 4.1 kb). RARA breakpoints were located in region A in 5 (21%) of 23 t-APL patients including one patient (GE477) who did not receive topoII targeting agents, and in 8 (32%) of 25 de novo APL patients (Fig. 1). Notably, in this region, we observed a 26 bp (Chr17: Genes, Chromosomes & Cancer DOI 10.1002/gcc

HASAN ET AL.

Figure 1. Genomic breakpoint distribution at RARA locus in de novo and t-APL patients. Region A include nucleotide location from 6,000 to 9,800 while region B consist of bases from 11,500 to 15,600 of RARA intron 2. Recombination prone sequences in region A and topoisomerase consensus in region B of RARA intron 2 have been shown. See text for details. [Color ﬁgure can be viewed in the online issue, which is available at www. interscience.wiley.com.]

7,348–7,373) recombination hotspot (RHS), a core sequence that is highly conserved in all reported ALU elements and reported to stimulate gene rearrangements (Rudiger et al., 1995) and recombination signal consensus sequences. By assuming that RHS distribute randomly/uniformly on the chromosome 17, we calculated the expected number of 26nt-sequences in a window of 16.9 kb and 3.8 kb region A of RARA intron 2. The 26 bp sequence was found only once in the 16.9 kb long region (P value ¼ 0.17) based on Poisson probability distribution. Such distribution supports the hypothesis that occurrence of these nucleotide sequences in region A (3.8 kb) and not in region B (4.1 kb) of RARA intron 2 are not just by chance. Moreover, in one t-APL patient (PAV) the RARA breakpoint (8,760–8,762) was located within a recombination signal sequence between the last nucleotide of a 23 bp spacer and the ﬁrst base of a nonamer (Chr17: 8,730–8,768). Matching sequences were 7 per nonamer and 4 per heptamer separated by a 23 bp spacer. RARA breakpoints in region B were detected in 15 (65%) of 23 t-APL patients, and 7 (28%) of 25 de novo APL patients (Fig. 1). To determine Genes, Chromosomes & Cancer DOI 10.1002/gcc

whether the breakpoints in regions A and B of RARA intron 2 differed signiﬁcantly from a uniform pattern, we used scan statistics. In region A (16,913 bp), none of the breakpoint clusters in de novo APL (eight events), t-APL (ﬁve events) and mitoxantrone related t-APL (four events) was found to be signiﬁcantly different from a random uniform pattern, with P values equaling 1, 0.91, and 0.97, respectively. In region B, breakpoints in t-APL (15 events) and mitoxantrone related t-APL (12 events) were identiﬁed to be signiﬁcantly clustered (P ¼ 0.001 and P ¼ 0.004, respectively). However, no signiﬁcant clusters were detected in de novo APL (seven events, P ¼ 1). Interestingly, nucleotide sequences of region B (Chr17: 11,795–11,815) showed 60% homology with a recently identiﬁed 21bp long DNA sequence preferentially cleaved by topoII in response to its inhibition (Masliah et al., 2008). On screening the entire RARA locus (GenBank accession number NM_000964.2), such high nucleotide homology was not detected elsewhere. With respect to PML breakpoints, in 8/19 (42%) t-APL cases DNA breaks in intron 6

t(15;17) GENOMIC BREAKPOINTS IN DE NOVO AND t-APL

Figure 2. Genomic breakpoint distribution at PML locus in de novo and t-APL patients. ‘‘Hot spot’’ region is an 8 bp long nucleotide sequence (AGCCCTAG) from 1,482–1,489 in PML intron 6. In both the ﬁgures numerals corresponds to de novo APL as described in Table 2 while alphabets are patient identiﬁcation numbers for therapyrelated APL. A, UPN8; C, UPN1; E, UPN7; H, UPN13; I, UPN11; J, UPN14; K, UPN4; M, UPN6; N, UPN5; O, UPN2; Q, UPN12; R, UNP10; S, UPN3; U, UPN9 described elsewhere (Hasan et al., 2008),

(GenBank accession number S57791) were located in a previously reported 8 bp ‘‘hot spot" region (Fig. 2), corresponding to a preferred site of mitoxantrone-induced DNA topoII cleavage as determined by functional assay (Mistry et al., 2005; Hasan et al., 2008). All except one patient (UPN12) with breaks in this particular region had received topoII targeted treatment with mitoxantrone prior to developing t-APL. In three (GE205, GE477, and UPN10) of the four t-APL cases in which there was no history of exposure to drugs targeting topoII, PML intron 6 breaks were located outside this hot spot. PML breakpoints in all 18 bcr1 positive de novo APL cases were found to fall outside the 8 bp hotspot region where 7 of 18 mitoxantrone related bcr1 positive patients were clustered (P ¼ 0.007) (Fig. 2, and Table 2). Genomic breakpoint junction sequences in 20 of 23 t-APL and 18 of 25 de novo APL cases showed 1–5 common nucleotides between PML and RARA loci at the breakpoint sites. The proximal end of RARA intron 2 (region A) consists of several recombination prone sequences including a 26-bp ALU core sequence that was suggested to be a recombinogenic hot spot. Webbased tools allowed the identiﬁcation of 9 ALU repeat elements in the region of 1,638–9,194 of RARA intron 2, whereas no such regions were detected on the PML gene. Heptamer and

unreported t-APL patient identiﬁcation codes are B, GE205; D, E477; F, GEI; G, PAV; P, CTN; T, GE723; V, MLN; W, VLN. GenBank accession numbers PML intron 6 (bcr1) S57791, PML intron 3 (bcr3) S51489 and native RARA intron 2 DNA sequence (GenBank accession number AJ297538) using the BLAST/alignment program of NCBI. [Color ﬁgure can be viewed in the online issue, which is available at www. interscience.wiley.com.]

TABLE 2. Genomic Breakpoint Locations in 25 De Novo APL Patient number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

Bcr isoform

PML breakpoints

RARA breakpoints

3 1 3 1 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 3 3 1

245–246 1,457 1,260–1,261 1,164–1,166 210–211 639–640 1,374 1,017 1,655–57 1,743–1,745 1,504–1,507 1,159–1,160 1,458–1,460 1,235 1,756 1,913–1,916 926–927 1,925–27 1,419–1,420 1,671 1,392–1,394 905–906 437 360–361 1,781–82

5,413–5,414 6,752 7,083–7,084 7,906–7,908 8,220–8,221 8,889–8,890 9,286 9,631 9,771–73 11,265–11,267 11,330–11,333 12,289–12,290 12,323–12,325 13,150 13,700 14,773–14,776 14,821–14,822 15,002–04 15,764–15,765 15,825 16,192–16,194 16,373–16,374 16,644 16,678–16,679 16,835–36

Genes, Chromosomes & Cancer DOI 10.1002/gcc

HASAN ET AL.

nonamer like V-D-J RSS were identiﬁed at nucleotide 5,296–8,769 of RARA intron 2 and interestingly in one patient RARA breakpoint was found within V-D-J RSS. The exact mechanisms that render these recombination regions prone to translocation remain unclear. However, Bassing et al. (2002) have proposed the mechanism of RAG-mediated DNA rearrangement through V-DJ RSS. RAG complexes can create DNA double strand breaks that may result in translocation (Leiber et al., 2006). However, although DNA breaks in region A between t-APL and de novo APL were not statistically signiﬁcant, the presence of recombination prone sequences in this region indicates a recombination mechanism can generate t(15;17) translocation. The topoII consensus sequences were identiﬁed at the distal end of RARA, 300bp downstream of region B where most of the t-APL cases arising after topoII-targeted therapy were clustered. This clustering of genomic breakpoints in RARA intron 2 region B was conﬁrmed by scan statistics. Furthermore, previously reported in vitro functional cleavage assays showed that the sequences within region B are indeed cleaved by topoII in response to topoII poisons such as mitoxantrone (Mistry et al., 2005; Hasan et al., 2008). The occurrence of breakpoint clustering at both PML and RARA loci in t-APL suggests a different pathogenetic mechanism underlying the disease as compared with de novo APL. By studying genomic breakpoints in de novo APL, Reiter et al. (2003) identiﬁed a strong clustering of topoII binding sites at nucleotide position 13,124–13,669 of RARA intron 2 which fall inside region B of our study. In agreement with Reiter et al., (2003); no RARA breakpoint was found in our series to fall within the previously reported (Tashiro et al., 1994) 50 bp hotspot located at distal end of RARA intron 2 (16,539–16,589). Mays et al. (2010) recently characterized genomic breakpoints in epirubicin related t-APL cases and showed site speciﬁc preferences of DNA damage at PML and RARA loci. The role of topoII poisons in the generation of the t(15;17) translocation was reinforced by our study analyzing genomic breakpoints of t-APL arising in multiple sclerosis patients who received single agent therapy with mitoxantrone (Hasan et al., 2008). In the study reported by Mays et al., (2010) breakpoint locations within the PML locus of the epirubicin-related t-APL cases were observed to occur outside the hotspot region in intron 6 Genes, Chromosomes & Cancer DOI 10.1002/gcc

(1,482–9) previously mapped in cases occurring after mitoxantrone treatment for breast cancer or multiple sclerosis (Mistry et al., 2005; Hasan et al., 2009). The precise mechanism of different drugs inducing preferential breakage at given genetic loci has remained subject to debate. Compounds that impact the catalytic activity of topoII can be separated into two categories. The ﬁrst includes drugs such as anthracylines (epirubicin) that decrease the overall activity of the enzyme and are known as catalytic inhibitors (Fortune and Osheroff, 2000; McClendon et al., 2007). Drugs in the second category e.g., etoposide, mitoxantrone increase levels of topoII-DNA cleavage complexes are called topoII poisons (Fortune and Osheroff, 2000; McClendon et al., 2007; Bender et al., 2008). Genomic breakpoint subcloning of nine patients with de novo AML provided evidence to suggest that the genomic rearrangement involved a recombination event between ALU sequences (Strout et al., 1998). In acute lymphoblastic leukemia with 11q23 translocations, the presence of heptamer–nonamer recombination signals in the vicinity of genomic breakpoints has suggested that VDJ recombinase activity is involved in illegitimate recombination events leading to these translocations (Thandla et al., 1997). A similar mechanism has not been identiﬁed in patients who develop therapy-related leukemia following treatment of the primary disorder with drugs that target topoII. Although several topoII DNA binding sites have been identiﬁed within the 11q23 breakpoint cluster region (bcr) (Gu et al., 1994), the mechanism of translocation associated with these drugs remains unclear. In summary, this study suggests a different distribution of breakpoints in either PML or RARA loci in de novo versus t-APL implying differences in t(15;17) translocation mechanism according to disease context. Although there is evidence supporting a role for recombination mechanisms underlying de novo APL, cases arising following exposure to topoII targeted agents are consistent with druginduced DNA damage followed by repair mediated by the nonhomologous end joining pathway. REFERENCES Abeysinghe SS, Chuzhanova N, Krawczak M, Ball EV, Cooper DN. 2003. Translocation and gross deletion breakpoints in human inherited disease and cancer. I. Nucleotide composition and recombination-associated motifs. Hum Mutat 22:229–244. Bassing CH, Swat W, Alt FW. 2002. The mechanism and regulation of chromosomal V(D)J recombination. Cell 109(Suppl): S45– S55.

t(15;17) GENOMIC BREAKPOINTS IN DE NOVO AND t-APL Beaumont M, Sanz M, Carli PM, Maloisel F, Thomas X, Detourmignies L, Guerci A, Gratecos N, Rayon C, San Miguel J, Odriozola J, Cahn JY, Huguet F, Vekhof A, Stamatoulas A, Dombret H, Capote F, Esteve J, Stoppa AM, Fenaux P. 2003. Therapy-related acute promyelocytic leukemia. J Clin Oncol 21:2123–2137. Bender RP, Osheroff N. 2008. DNA topoisomerases as targets for the chemotherapeutic treatment of cancer. In: Dai W, editor. Checkpoint Responses in Cancer Therapy. Totowa, NJ: Humana Press, pp. 57–91. Fortune JM, Osheroff N. 2000. Topoisomerase II as a target for anticancer drugs: When enzymes stop being nice. Prog Nucleic Acid Res Mol Biol 64:221–253. Gebow D, Miselis N, Liber HL. 2000. Homologous and nonhomologous recombination resulting in deletion: Effects of p53 status, microhomology, and repetitive DNA length and orientation. Mol Cell Biol 20:4028–4035. Gellert M. 1992. V(D)J recombination gets a break. Trends Genet 8:408–412. Gu Y, Cimino G, Alder H, Nakamura T, Prasad R, Canaani O, Moir DT, Jones C, Nowell PC, Croce CM, Canaani E. 1992. The (4;11)(q21;q23) chromosome translocations in acute leukemias involve the VDJ recombinase. Proc Natl Acad Sci USA 89: 10464–10468. Gu Y, Alder H, Nakamura T, Schichman SA, Prasad R, Canaani O, Saito H, Croce CM, Canaani E. 1994. Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. Cancer Res 54:2326–2330. Haluska FG, Finver S, Tsujimoto Y, Croce CM. 1986. The t(8; 14) chromosomal translocation occurring in B-cell malignancies results from mistakes in V-D-J joining. Nature 324:158–161. Hasan SK, Mays AN, Ottone T, Ledda A, La Nasa G, Cattaneo C, Borlenghi E, Melillo L, Montefusco E, Cervera J, Stephen C, Satchi G, Lennard A, Libura M, Byl JA, Osheroff N, Amadori S, Felix CA, Voso MT, Sperr WR, Esteve J, Sanz MA, Grimwade D, Lo-Coco F. 2008. Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis. Blood 112: 3383–3390. Kolomietz E, Meyn MS, Pandita A, Squire JA. 2002. The role of Alu repeat clusters as mediators of recurrent chromosomal aberrations in tumors. Genes Chromosomes Cancer 35:97–112. Lieber MR, Yu K, Raghavan SC. 2006. Roles of nonhomologous DNA end joining, V(D)J recombination, and class switch recombination in chromosomal translocations. DNA Rep (Amst) 5:1234–1245. Lobachev KS, Stenger JE, Kozyreva OG, Jurka J, Gordenin DA, Resnick MA. 2000. Inverted Alu repeats unstable in yeast are excluded from the human genome. 19:3822–3830. Masliah G, Rene B, Zargarian L, Fermandjian S, Mauffret O. 2008. Identiﬁcation of intrinsic dynamics in a DNA sequence preferentially cleaved by topoisomerase II enzyme. J Mol Biol 381:692–706. Mays AN, Osheroff N, Xiao Y, Wiemels JL, Felix CA, Byl JA, Saravanamuttu K, Peniket A, Corser R, Chang C, Hoyle C, Parker AN, Hasan SK, Lo-Coco F, Solomon E, Grimwade D. 2010. Evidence for direct involvement of epirubicin in the formation of chromosomal translocations in t(15;17) therapy-related acute promyelocytic leukemia. Blood 115:326–330. McClendon AK, Osheroff N. 2007. DNA topoisomerase II, genotoxicity, and cancer. Mutat Res 623:83–97. Mistry AR, Felix CA, Whitmarsh RJ, Mason A, Reiter A, Cassinat B, Parry A, Walz C, Wiemels JL, Segal MR, Ade`s L, Blair IA,

Osheroff N, Peniket AJ, Lafage-Pochitaloff M, Cross NCP, Chomienne C, Solomon E, Fenaux P, Grimwade D. 2005. DNA topoisomerase II in therapy-related acute promyelocytic leukemia. N Engl J Med 352:1529–1538. Reichel M, Gillert E, Nilson I, Siegler G, Greil J, Fey GH, Marschalek R. 1998. Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): The DNA damage-repair model of translocation. Oncogene 17:3035– 3044. Reiter A, Saussele S, Grimwade D, Wiemels JL, Segal MR, LafagePochitaloff M, Walz C, Weisser A, Hochhaus A, Willer A, Reichert A, Bu¨chner T, Lengfelder E, Hehlmann R, Cross NCP. 2003. Genomic anatomy of the speciﬁc reciprocal translocation t(15;17) in acute promyelocytic leukemia. Genes Chromosomes Cancer 36: 175–188. Rudiger NS, Gregersen N, Kielland-Brandt MC. 1995. One short well conserved region of Alu-sequences is involved in human gene rearrangements and has homology with prokaryotic chi. Nucleic Acids Res 23:256–260. Segal MR, Wiemels JL. 2002. Clustering of translocation breakpoints. J Am Stat Assoc 97:66–76. Stenger JE, Lobachev KS, Gordenin D, Darden TA, Jurka J, Resnick MA. 2001. Biased distribution of inverted and direct Alus in the human genome: Implications for insertion, exclusion, and genome stability. Genome Res 11:12–27. Strout MP, Marcucci G, Bloomﬁeld CD, Caligiuri MA. 1998. The partial tandem duplication of ALL1 (MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia. Proc Natl Acad Sci USA 95:2390–2395. Tashiro S, Kotomura N, Tanaka K, Suzuki K, Kyo T, Dohy H, Niwa O, Kamada N. 1994. Identiﬁcation of illegitimate recombination hot spot of the retinoic acid receptor alpha gene involved in 15;17 chromosomal translocation of acute promyelocytic leukemia. Oncogene 9:1939–1945. Thandla S, Aplan PD. 1997. Molecular biology of acute lymphocytic leukemia. Semin Oncol 24:45–56. Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM. 1985. The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science 229:1390–1393. vander Reijden BA, Dauwerse HG, Giles RH, Jagmohan-Changur S, Wijmenga C, Liu PP, Smit B, Wessels HW, Beverstock GC, Jotterand-Bellomo M, Martinet D, Mu¨hlematter D, LafagePochitaloff M, Gabert J, Reiffers J, Bilhou-Nabera C, van Ommen GB, Hagemeijer A, Breuning MH. 1999. Genomic acute myeloid leukemia-associated inv(16)(p13q22) breakpoints are tightly clustered. Oncogene 18:543–550. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Gonza´lez Dia´z M, Malec M, Langerak AW, San Miguel JF, Biondi A. 1999. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 13:1901–1928. Yoshida H, Naoe T, Fukutani H, Kiyoi H, Kubo K, Ohno R. 1995. Analysis of the joining sequences of the t(15;17) translocation in human acute promyelocytic leukemia: Sequence nonspeciﬁc recombination between the PML and RARA genes within identical short stretches. Genes Chromosomes Cancer 12:37–44. Zhang Y, Rowley JD. 2006. Chromatin structural elements and chromosomal translocations in leukemia. DNA repair 5:1282– 1297.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

Chapter 5 Genomic characterization of t(16;21) translocation in therapy-related acute myeloid leukemia

GENES, CHROMOSOMES & CANCER 48:213–221 (2009)

RESEARCH ARTICLES

Identification of a Potential ‘‘Hotspot’’ DNA Region in the RUNX1 Gene Targeted by Mitoxantrone in Therapy-Related Acute Myeloid Leukemia with t(16;21) Translocation Tiziana Ottone,1 Syed Khizer Hasan,1 Enrico Montefusco,2 Paola Curzi,3 Ashley N. Mays,4 Luciana Chessa,2 Antonella Ferrari,2 Esmeralda Conte,2 Nelida Ine´s Noguera,1 Serena Lavorgna,1 Emanuele Ammatuna,1 Mariadomenica Divona,3 Katia Bovetti,1 Sergio Amadori,1 David Grimwade,4 and Francesco Lo-Coco1,3* 1

Dipartimento di Biopatologia e Diagnostica per Immagini,University ‘‘Tor Vergata,’’Rome,Italy Azienda Ospedaliera Sant’Andrea,University ‘‘La Sapienza,’’Rome,Italy 3 Dipartimento di Medicina di Laboratorio,PoliclinicoTor Vergata,Rome,Italy 4 Department of Medical and Molecular Genetics,King’s College London School of Medicine,London,UK 2

The translocation t(16;21) involving RUNX1 (AML1) and resulting in the RUNX1-CBFA2T3 fusion is a rare but recurrent abnormality mostly found in therapy-related acute myeloid leukemia (t-AML) associated with agents targeting topoisomerase II (topo II). We characterized, at the genomic level, the t(16;21) translocation in a patient who developed t-AML after treatment of multiple sclerosis with mitoxantrone (MTZ). Long template nested PCR of genomic DNA followed by direct sequencing enabled the localization of RUNX1 and CBFA2T3 (ETO2) breakpoints in introns 5 and 3, respectively. Sequencing of the cDNA with speciﬁc primers showed the presence of the expected RUNX1-CBFA2T3 fusion transcript in leukemic cells. The RUNX1 intron 5 breakpoint was located at nucleotide position 24,785. This region contained an ATGCCCCAG nucleotide sequence showing 90% homology to a ‘‘hotspot’’ DNA region ATGCCCTAG present in intron 6 of PML previously identiﬁed in therapy-related acute promyelocytic leukemia cases arising following treatment with MTZ. This study suggests a wider distribution in the human genome, and particularly at genes involved in chromosome translocations C 2008 Wiley-Liss, Inc. V observed in t-AML, of DNA regions (hotspot) targeted by speciﬁc topo II drugs. INTRODUCTION

Hematopoietic malignancies are frequently characterized by recurrent chromosomal translocations involving genes that play an important role in the regulation of hematopoietic cell proliferation and differentiation (Renneville et al., 2008). The RUNX1 (AML1) gene at cytogenetic band 21q22 is one of the most frequent targets of chromosomal translocations observed in both de novo acute leukemia and therapy-related myelodysplastic syndrome (t-MDS) and acute myeloid leukemia (t-AML). Translocations involving RUNX1 have been reported in 15% of t-MDS/t-AML cases, and the most common chromosome/gene rearrangements described in this clinical context are the t(8;21)(q22;q22), t(3;21)(q26;q22) and t(16;21)(q24;q22) translocations involving the CBFA2T1 (ETO1), EAP/MDS1/EVI1, and CBFA2T3 (ETO2) genes, respectively (Slovak et al., 2002). The t(16;21)(q24;q22) is a rare but nonrandom chromosome abnormality associated mostly with t-AML (Nucifora and Rowley, 1995; Gamou C 2008 Wiley-Liss, Inc. V

et al., 1998; Roulston et al., 1998). It involves CBFA2T3 (myeloid translocation gene on chromosome 16), which encodes one of the family of novel transcriptional corepressors (MTG proteins) and shows a high degree of homology to the CBFA2T1 gene, the fusion partner in the t(8;21) (Gamou et al., 1998). The evolutionarily conserved structural features between RUNX1CBFA2T1 and RUNX1-CBFA2T3 (Gamou et al., 1998) suggests that the two chimeric proteins are both involved in hematopoiesis, as subsequently demonstrated in functional studies (Rossetti et al., 2005).

Supported by: The Italian Ministry of Health (Progetto Integrato Oncologia), AIRC (Associazione Italiana per la Ricerca sul Cancro), Leukaemia Research Fund of Great Britain. *Correspondence to: Francesco Lo-Coco, Department of Biopathology, University Tor Vergata, Via Montpellier 1, 00133 Roma, Italy. E-mail: [emailprotected] Received 18 August 2008; Accepted 16 October 2008 DOI 10.1002/gcc.20633 Published online 20 November 2008 in Wiley InterScience (www.interscience.wiley.com).

214

OTTONE ET AL.

As observed in t(8;21), the RUNX1 breakpoints in the t(16;21) are localized between exons 5 and 6 of RUNX1, immediately downstream of a phylogenetically conserved DNA-binding domain, whereas breakpoints in CBFA2T3 are usually localized between exons 1 and 2 or exons 3 and 4 (Gamou et al., 1998; Zhang et al., 2002). However, to our knowledge, no studies have yet analyzed this aberration at the genomic level. Genomic studies of translocations associated with t-AML are relevant to identify DNA regions targeted by cytotoxic agents, in particular drugs targeted by topoisomerase II (topo II) and may provide important clues in the understanding of t-AML pathogenesis. Recently, Mistry et al. (2005) demonstrated that drug-induced cleavage of DNA by topo II mediates the formation of chromosomal translocation breakpoints in mitoxantrone (MTZ)-related acute promyelocytic leukemia (APL) and in APL developing after therapy (t-APL) with other drugs targeting topo II. Here, we report the characterization at the genomic level of the t(16;21) translocation in a 49-year-old man who developed t-AML after treatment with MTZ given for multiple sclerosis (MS). This investigation allowed the identiﬁcation of a novel potential ‘‘hotspot’’ in the RUNX1 gene, which is targeted by MTZ and shows a high degree of homology to the previously deﬁned hotspot sequence present in PML intron 6 (Mistry et al., 2005; Hasan et al., 2008).

MATERIALS AND METHODS Case History

A 49-year-old man with a 3-year history of MS was admitted at the Institute of Hematology, Hospital of S. Andrea, University ‘‘La Sapienza’’ of Rome, in February 2008, for severe pancytopenia. He had been treated for MS with MTZ (15 mg every 2 months for 1 year) receiving a total cumulative dose of 90 mg. On admission, laboratory evaluations revealed hemoglobin 8.8 g/ dl, WBC 5,130/mm3 and platelet count 56,000/ mm3. Bone marrow examination disclosed 35% inﬁltration by peroxidase positive granular blasts with some Auer bodies. Flow cytometric immunophenotyping performed on bone marrow cells demonstrated a predominance of leukemic blasts staining positive for CD33/HLA-DR/CD13/ CD19/CD117 and negative for CD14/CD64/ CD34/CD9. Based on the morphological and Genes, Chromosomes & Cancer DOI 10.1002/gcc

cytochemical ﬁndings, a diagnosis of AML-M2 was established according to the French-American-British criteria (Bennett et al., 1976). Patient received standard induction therapy with ﬂudarabin, cytarabine and G-CSF (FLAG regimen), and achieved complete remission in March 2008. He therefore received consolidation chemotherapy according to the same protocol and presently persists in hematologic remission at 5 months from diagnosis. Conventional Cytogenetic and FISH Analyses

Conventional karyotyping was performed on the bone marrow diagnostic aspirate after shortterm culture and analyzed after G-banding. The description of the karyotype was according to the International System for Human Cytogenetic Nomenclature (ISCN, 1995). For FISH analysis, fresh slides were prepared from the cytogenetic pellets stored in ﬁxative and allowed to dry for 20 min at 80 C on a hot plate (Hybrite, Vysis, Downers Grove, IL) followed by dehydration at room temperature (RT) in 70, 80, and 100% ethanol (3 min each). Codenaturation was carried out at 68 C for 5 min and hybridization at 37 C in a humid chamber over-night using whole chromosome painting probes of chromosome 16 and 21 (Vysis). Posthybridization washing was done at 72 C in 0.5 SSC for 2 min and for 5 min in 4T solution (SSC 2, Tween 20). Slides were washed and counterstained with 40 ,60 diamine-2-phenylindole dihydrochloride (DAPI) (Vysis) and analyzed using an Olympus BX65 microscope equipped with a 100-W lamp and a complete set of ﬁlters. Molecular Screening of Recurring AML Fusion Genes and Mutations

Total RNA was extracted from Ficoll-Hypaque-isolated bone marrow mononuclear cells using standard procedures (Chomczynsky and Sacchi, 1987) and reverse-transcribed using random hexamers as primers. According to our routine laboratory protocol for AML genetic diagnosis, cDNA was used to amplify the most common AML gene fusions, i.e., RUNX1CBFA2T1, PML-RARA, CBFB-MYH11, and DEKCAN as described in protocols standardized by the European BIOMED-I Concerted Action (van Dongen et al., 1999) as well as for the mutational analysis of FLT3, NPM1, and JAK2 genes (Baxter et al., 2005; Noguera et al., 2005). High-molecular

215

HOTSPOT RUNX1 BREAKPOINT IN t(16;21) OF A t-AML

TABLE 1. Primers Used in This Study Number F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 F13 F14 F15 F16 F17 R18 R19 R20 R21 R22 R23 R24 R25 R26 / / / / / / / /

Name

Sequence

Applicationa

RUNX1-F1 RUNX1-F2 RUNX1-F3 RUNX1-F4 RUNX1-F5 RUNX1-F6 RUNX1-F7 RUNX1-F8 RUNX1-F8-1 RUNX1-F8-2 RUNX1-F8-3 RUNX1-F8-4 RUNX1-F8-5 RUNX1-F8-6 RUNX1-F8-7 RUNX1-F8-8 RUNX1-F8-9 CBFA2T3-R1-6 CBFA2T3-R1-5 CBFA2T3-R1-4 CBFA2T3-R1-3 CBFA2T3-R1-2 CBFA2T3-R1-1 CBFA2T3-R1 CBFA2T3-R2 CBFA2T3-R3 AML1-Ab CBFA2T3-rev CBFA2T3-forw RUNX1-rev CBFA2T3-F1-ex2 RUNX1-R1-ex7 ABL-A2B-5 ABL-A3E-3

ATCCACTTGGGGCTGGTACAC CTTATAGACTCTTTGACCTGGCCTC AATCGTATACCTTGCCCAAAGTC GTCAGAAAGAAAAGTCACGTGTGG TGCCTACTGCACAGGGTTCTTG AATGAGGCTGTCATGACACAAAC TTCATTCAGCCAACATTAGTGAGC GTACTCCAACCTTGTGGTGTTGTC TGAGTATCCAATTGACTGGCCAA GCAGCTCGGTTATCAACGAGATA TGTTCAGAGCTGCATCCTGGTT CATTGTGAGCCTGAGGGTCAA TGGCTGTAGACTCTACCACGTCAA GAGTCACACCATGGCTGACCAA TGAGACAATGTCAACTGTGCCAA TATATAGACACTGAGGGGCCCAT CCAACAATTAATGCGCCTCTT CAACACAACAGAGGCAAT CATTTTACAGGTGGGGAAAC CACAGAATAATGGCTGTGAA ACGACAGGTGTGTTCCTAA GTCAGGACTGTGGACCTT CCTGGCTTGAACGATCTTA CCACACCTAGTGGAATTCTGGAA GCTGAGTGTTGTGGCCTCTGT GGTGACAACACAACCCAGACG CTACCGCAGCCATGAAGAACC TGGGTGTGCACGGTGCACCATT GAGGTCTTCACCGCAGCATC CTATTGTGGGGAGCAGGGAG CCCAGTGGACAGGAAAGCTAACG GCACAGAAGGAGAGGCAATGGAT GCATCTGACTTTGAGCCTCAG TGACTGGCGTGATGTAGTTGCTT

LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP LTP and nested PCR LTP LTP LTP and nested PCR LTP LTP LTP LTP LTP LTP RT-PCR of RUNX1/CBFA2T3 RT-PCR of RUNX1/CBFA2T3 PCR for genomic CBFA2T3/RUNX1 PCR for genomic CBFA2T3/RUNX1 RT-PCR of CBFA2T3/RUNX1 RT-PCR of CBFA2T3/RUNX1 RT-PCR for ABL RT-PCR for ABL

LTP, long range template PCR. van Dongen et al., 1999.

weight DNA was isolated by proteinase K digestion and phenol/chloroform extraction (Sambrook et al., 1989) and used for long template PCR (LTP) to characterize the exact chromosome breakpoint position in RUNX1 (genomic coordinates chr21:35081968-35343465) and CBFA2T3 (genomic coordinates chr16:87468768-87570902) genes. RUNX1 and CBFA2T3 gene annotations were adapted using the University of California at Santa Cruz (UCSC) Genome Browser Reference Sequence (Refseq) gene track. Long Template PCR to Amplify the DNA Spanning Possible Breakpoints in RUNX1-CBFA2T3

To characterize the RUNX1-CBFA2T3 fusion at the genomic level, leukemic DNA was ampliﬁed by a two-step LTP method. Seventeen forward and nine reverse primers were designed to cover

the 24.7-kb long RUNX1 intron 5 and 5.5-kb long CBFA2T3 intron 3 (Table 1 and Fig. 1). LTP containing an enzyme mix of thermostable Taq DNA polymerase and a proof-reading polymerase was performed following the manufacturer’s instructions (TAKARA Biotechnology, Dalian Biotechnology, Dalian). In the ﬁrst round of LTP, carried out using a Gene Amp PCR System 2400 (Perkin-Elmer, Emeryville, CA), 400 ng of genomic DNA, 500 nM of each primer, 400 lM dNTPs, and 2.5 U of TAKARA long Taq polymerase (Biotechnology, Dalian) was used in a total reaction volume of 50 ll. After an initial melting step of 1 min at 94 C, ﬁrst and second rounds of the reaction consisted of 30 cycles of 98 C for 10 sec and 15 min at 68 C (annealing/ extension) followed by a ﬁnal extension at 72 C for 10 min. For sequencing purposes, nested PCR products were generated using 0.5 ll of the Genes, Chromosomes & Cancer DOI 10.1002/gcc

216

OTTONE ET AL.

Figure 1. Schematic representation of position of primers for long template PCR. F1-17 are forward (RUNX1) primers and R18-26 are (CBFA2T3) reverse primers.

second-round LTP reaction and a pair of primers RUNX1-F8-9 and CBFA2T3-R1-4 (Table 1) located in close proximity to the RUNX1 and CBFA2T3 breakpoints. Preheating of the mixture at 95 C for 7 min was followed by 30 cycles of 45 sec at 95 C, 45 sec at 55 C, 2 min at 72 C, and ﬁnal extension of 7 min at 72 C. An aliquot (5 ll) of nested PCR product was subjected to electrophoresis on a 2% (w/v) agarose gel to check the size of the PCR product, and then the remaining PCR product was puriﬁed using a QIAquick PCR extraction kit (Qiagen, Chatsworth, CA) for sequencing analysis. Samples were loaded in 96well plates and covered with mineral oil. The ampliﬁed products were separated with a capillary electrophoresis-based system (CEQ 8000 Genetic Analysis system, Beckman Coulter, USA) using the ‘‘LFR1 test’’ default run method. Based on the RUNX1-CBFA2T3 fusion and to conﬁrm the genomic breakpoint, 1 ll of cDNA was analyzed using the primers AML1-A and CBFA2T3-rev (Table 1). Preheating of the mixture at 95 C for 7 min was followed by 35 cycles of 30 sec at 95 C, 45 sec at 67 C, 45 sec at 72 C, and ﬁnal extension of 7 min at 72 C. PCR products were visualized by electrophoresis on a 2% (w/v) agarose gel. Ampliﬁcation of the Reciprocal CBFA2T3-RUNX1 Genomic Breakpoint Junction

On the basis of RUNX1 and CBFA2T3 breakpoints, genomic CBFA2T3-RUNX1 was ampliﬁed following the design of speciﬁc primers, CBFA2T3-forw and RUNX1-rev (Table 1) using 100 ng of fresh DNA. Preheating of the mixture at 95 C for 7 min was followed by 35 cycles of 30 sec at 95 C, 45 sec at 64 C, 45 sec at 72 C, and ﬁnal extension of 7 min at 72 C. PCR products were visualized by electrophoresis on a 2% (w/v) agarose gel. Genes, Chromosomes & Cancer DOI 10.1002/gcc

To determine if the reciprocal CBFA2T3RUNX1 chimera was expressed, 1 ll of cDNA was ampliﬁed using the CBFA2T3-F1-ex2 and RUNX1-R1-ex7 primers (Table 1). Preheating of the mixture at 95 C for 7 min was followed by 35 cycles of 30 sec at 95 C, 45 sec at 58 C, 45 sec at 72 C, and ﬁnal extension of 7 min at 72 C. An aliquot (5 ll) of PCR product was visualized by electrophoresis on 2% (w/v) agarose gel, and the remaining PCR product was puriﬁed with a QIAquick PCR extraction kit (Qiagen) and used for sequencing analysis. To conﬁrm the integrity of RNA and to ensure adequate cDNA synthesis, for each RT-PCR reaction, the housekeeping ABL gene was ampliﬁed. A 258-bp fragment was obtained from 1 ll of cDNA using the ABL-A2B-5 and ABL-A3E-3 primers (Table 1). Preheating of the mixture at 95 C for 7 min was followed by 35 cycles of 30 sec at 95 C, 45 sec at 65 C, 45 sec at 72 C, and ﬁnal extension of 7 min at 72 C. PCR products were visualized by electrophoresis on a 2% (w/v) agarose gel. All PCR experiments were performed on a Gene Amp PCR system 2400 (Perkin-Elmer) in a 25-ll ﬁnal volume containing 0.7 U of Taq Gold DNA Polymerase (Applied Biosystems), 10 PCR buffer, 0.2 mmol/l deoxynucleoside-5-triphosphates, 2.5 mM MgCl2, and 10 pmol of each primer.

Alignment of Sequenced Nucleotides Using BLAST Algorithm

Patient’s genomic RUNX1-CBFA2T3 junction sequences were aligned against normal RUNX1 intron 5 and CBFA2T3 intron 3 nucleotides as a reference text input in the BLAST/alignment program to detect the microhomologies in the vicinity of breakpoint location.

HOTSPOT RUNX1 BREAKPOINT IN t(16;21) OF A t-AML

217

Figure 2. (A) A bone marrow G-banded metaphase showing a 46,XY, t(16;21)(q24;q22) karyotype. The arrows show the rearranged chromosomes. (B) FISH with painting chromosome 16 (red) and chromosome 21 (green). The normal chromosome 16 is red,

whereas the der(16) (arrow) has both red and green signals. Both normal 21 and der(21) (arrowhead) show only green signals. [Color ﬁgure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

RESULTS

reverse primers, we ampliﬁed the genomic RUNX1-CBFA2T3 junction region using RUNX1F8-9 and CBFA2T3-R1-4 primers (Table 1). DNA breakpoints in the RUNX1 and CBFA2T3 genes were localized in intron 5 (chr21:3512876935153640) and intron 3 (chr16:8748639587491986), respectively. The RUNX1 genomic breakpoint in intron 5 was localized at nucleotide position chr21:35128855-35128856, whereas the breakpoint in CBFA2T3 intron 3 was detected at nucleotide position chr16:87491463-87491464 with one base microhomology at the breakpoint junction precluding the precise assignment of the breakpoint (Fig. 3D). The RUNX1 breakpoint region contained an ATGCCCCAG nucleotide sequence showing 90% homology to a hotspot DNA region ATGCCCTAG contained in PML intron 6 gene previously identiﬁed in t-APL cases arising following treatment with MTZ (Mistry et al., 2005). Microhomologies at the breakpoint junctions in t(16;21) were indicative of DNA repair by the nonhomologous end-joining (NHEJ) pathway (Lovett et al., 2001a). Based on the RUNX1 and CBFA2T3 breakpoints, the reciprocal CBFA2T3-RUNX1 genomic translocation was ampliﬁed by PCR with speciﬁc primers. A fragment of the expected size corresponding to a reciprocal translocation CBFA2T3RUNX1 was visualized by agarose gel electrophoresis. Sequencing analysis of the PCR product conﬁrmed a balanced chromosome translocation with no insertions/deletions at the genomic level (Fig. 4).

Conventional Cytogenetic and FISH Analyses

Cytogenetic analysis of bone marrow cells revealed an abnormal karyotype with a translocation involving chromosome 16 and 21 in 5 of 10 metaphases analyzed resulting in the karyotype 46,XY,t(16;21)(q24;q22)[5]/46,XY[5] (Fig. 2A). Dual-color painting FISH analysis showed the translocation of the distal 21q (Fig. 2B) to the 16q derivative, but failed to reveal the reciprocal translocation, suggesting that the 16q segment was too small to be detected with painting FISH analysis or, alternatively, its deletion. However, sequencing results (see later) were in agreement with the former assumption. Molecular Screening of Recurring AML Fusion Genes and Mutations

Screening for RUNX1-CBFA2T1, PML-RARA, CBFB-MYH11, and DEK-CAN fusion genes was negative. Mutational analysis showed no alterations in the FLT3 and NPM1 genes. The study of mutational status of the JAK2 gene showed the presence of the V617F mutation in leukemic cells. Location of t(16;21) Translocation Breakpoints Within the RUNX1 and CBFA2T3 Loci

A LTP strategy followed by direct sequencing was adopted to identify RUNX1 and CBFA2T3 breakpoints (Figs. 3A and 3B). After a series of PCRs with different combinations of forward and

Genes, Chromosomes & Cancer DOI 10.1002/gcc

218

OTTONE ET AL.

Figure 3. (A) Long template PCR (LTP) for genomic RUNX1CBFA2T3 analysis. Lane 1, ampliﬁcation product of ﬁrst round of LTP using F6 and R26 primers (10993 bp). Lane 2, second round of LTP using F8 and R26 primers (4991 bp). Lane 3, nested PCR reaction using F17 and R20 primers (570 bp); M molecular weight marker. (B) Sequence trace showing the genomic breakpoint position in RUNX1-CBFA2T3 fusion genes. (C) RT-PCR analysis of the RUNX1-

CBFA2T3 chimeric transcript. Lane 1, ABL ampliﬁcation used as internal PCR control (258 bp); M, molecular weight marker. Lane 2, RUNX1-CBFA2T3 ampliﬁcation product (231 bp). (D) Schematic representation of relevant primers and nucleotide sequences in the vicinity of the breakpoint. RUNX1 and CBFA2T3 gene annotations were adapted using the University of California at Santa Cruz (UCSC) Genome Browser Reference Sequence (Refseq) gene track.

Figure 4. The der(21) and der(16) genomic breakpoint junctions. The nucleotide sequence underlined in RUNX1 gene shows 90% homology with a ‘‘hotspot’’ DNA region contained in PML intron 6 gene (*Mistry et al., 2005).

The results of RNA studies showed the expression of the RUNX1-CBFA2T3 chimeric gene corresponding to an expected product size Genes, Chromosomes & Cancer DOI 10.1002/gcc

of 231 bp in the diagnostic sample (Fig. 3C). Sequence analysis of the PCR product conﬁrmed this ﬁnding and was consistent with fusion

HOTSPOT RUNX1 BREAKPOINT IN t(16;21) OF A t-AML

between exon 5 of RUNX1 and exon 4 of CBFA2T3 genes in accordance with the genomic breakpoints identiﬁed by LTP PCR. The expression of the reciprocal CBFA2T3-RUNX1 chimera was examined using speciﬁc primers; the CBFA2T3-RUNX1 fusion was not ampliﬁed indicating lack of expression of the reciprocal chimeric gene (data not shown).

DISCUSSION

In this report, which represents the ﬁrst description at the genomic level of breakpoints involved in the t(16;21) translocation in t-AML, we describe a novel potential hotspot DNA region targeted by MTZ. This region shows striking homology to a previously identiﬁed region present in the PML gene, also targeted by the same agent and described as a preferential DNA break site in t-APL developing after treatment of breast cancer (Mistry et al., 2005). Following the report by Mistry et al. (2005), we have recently analyzed a series of t-APL cases occurring after MTZ treatment for MS at the genomic level. Interestingly, in 5 of 12 cases breakpoints were localized in the same 8-bp PML hotspot region identiﬁed by Mistry et al. (Hasan et al., 2008). Twenty-one cases of acute leukemia with the t(16;21)(q24;q22) translocation have been described so far in the literature, including 17 patients who were affected by t-AML developing after chemotherapy and/or radiotherapy (Berger et al., 1996; Shimada et al., 1997; Takeda et al., 1998; Mitelman et al., 2008; Zatkova et al., 2007; Boils and Mohamed, 2008). Although the type of chemotherapy agents used for the primary tumor is not always detailed in the published series, most patients with this aberration had received agents targeting topo II including MTZ and etoposide. Of the 17 t-AML cases, 13 were analyzed by FISH and/or RT-PCR with demonstration in all instances of the RUNX1-CBFA2T3 fusion (Boils and Mohamed, 2008), while in none of them a genomic investigation of t(16;21) breakpoints was carried out. It is well established that t-AML developing after previous therapy with topo II targeting drugs is associated with balanced chromosome translocations such as those involving MLL at band 11q23 (Bloomﬁeld et al., 2002; Olney et al., 2002; Rowley and Olney, 2002; Schoch et al., 2003), RUNX1 at 21q22 (Slovak et al., 2002) and PML at 15q22 (Mistry et al., 2005). The resulting

219

gene fusions are likely due to illegitimate recombination that follows DNA damage induced by the drugs. Previous studies have established the presence of functional topo II cleavage sites at translocation breakpoints in MLL-associated tAML (Lovett et al., 2001a,b; Whitmarsh et al., 2003) as well as in the PML gene in t-APL (Mistry et al., 2005; Hasan et al., 2008). Combined with the identiﬁcation of nucleotide microhomologies at the translocation breakpoints, these data suggest that direct DNA damage at hotspot DNA regions coupled with aberrant repair by the NHEJ pathway is likely to be relevant to the formation of these translocations and ultimately to tAML pathogenesis. By studying cell lines treated with various chemotoxic agents, Stanulla et al. (1997) identiﬁed another region within the RUNX1 locus, located only 360 bp upstream of the hereby described breakpoint, which is highly sensitive to double-strand DNA cleavage induced by various drugs targeting topo II. Although in vitro cleavage assays are the most reproducible experiments to establish a relationship between topo II targeting agents and translocation breakpoint sites, it should be considered that chromatin structure will limit access to these sites and may therefore change the apparent cleavage preference in vivo. In this context, a study by Mirault et al. (2006) showed that in vivo DNA cleavage by topoisomerase poisoning and apoptotic nuclease contribute synergistically to the generation of translocation breakpoints. Although in this report we did not perform functional in vitro studies to demonstrate the preferential MTZ targeting at the identiﬁed breakpoint, the considerably high homology of the detected sequence in our case with the hotspot described in PML by Mistry et al. (2005) and Hasan et al. (2008) strongly suggests that the ATGCCCCAG RUNX1 sequence also represents a preferential target of topo II induced cleavage in the presence of this agent. In a study by Zhang et al. (2002) focusing on de novo t(8;21), the authors found a strong correlation of genomic breakpoints in RUNX1 and CBFA2T1 gene with in vivo topo II cleavage and DNAase I hypersensitive sites. Unfortunately, to the best of our knowledge, no studies which analyze MTZ-associated RUNX1 breakpoints at the DNA sequence level in either t(8;21) or t(16;21) t-AML patients have been carried out so far. It is likely that these genomic investigations will lead to the identiﬁcation of other identical or highly homologous hotspots targeted by topo II drugs, Genes, Chromosomes & Cancer DOI 10.1002/gcc

220

OTTONE ET AL.

giving rise to other recurrent translocations associated with t-AML. Although site-speciﬁc DNA cleavage induced by drugs targeting topo II at speciﬁc genes most likely represent the initial step leading to chromosomal translocations and resultant leukemia induced by these agents, additional events may be required for the development of the full leukemic phenotype. As to the coexistence in this case of the JAK2 V617F mutation with the t(16;21) translocation, this has not been reported to date. Our ﬁnding is in keeping with previous reports of cases of t-AML with both t(8;21) and JAK2 V617F (Do¨hner et al., 2006; Lee et al., 2006; Schnittger et al., 2007) suggesting that this alteration may represent a cooperating event in therapy-related leukemogenesis. In conclusion, our ﬁndings highlight the relevance of genomic analysis to characterize DNA breakpoints in therapy-related leukemias and should foster similar investigations in other types of translocations associated with both de novo and secondary leukemia. In particular, comparison of the various aberrations among primary and secondary cases may provide relevant insights into leukemia pathogenesis and should lead to potential identiﬁcation of novel hotspot regions at involved gene breakpoint sites. These studies may in fact allow the generation of models as to how these chromosomal translocations could have been formed and ultimately improve our understanding of leukemia pathogenesis.

REFERENCES Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN, Green AR;Cancer Genome Project. 2005. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 365:1054–1061. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. 1976. Proposals for the classiﬁcation of the acute leukaemias. French-American-British (FAB) co-operative group. Br J Haematol 4:451–458. Berger R, Le Coniat M, Romana SP, Jonveaux P. 1996. Secondary acute myeloblastic leukemia with t(16;21) (q24;q22) involving the AML1 gene. Hematol Cell Ther 38:183–186. Bloomﬁeld CD, Archer KJ, Mro´zek K, Lillington DM, Kaneko Y, Head DR, Cin PD, Raimondi SC. 2002. 11q23 balanced chromosome aberrations in treatment-related myelodysplastic syndromes and acute leukemia: Report from an International Workshop. Genes Chromosomes Cancer 33:362–378. Boils CL, Mohamed AN. 2008. t(16;21)(q24;q22) in acute myeloid leukemia: Case report and review of the literature. Acta Haematol 119:65–68. Chomczynsky P, Sacchi N. 1987. Single step method of RNA isolation by acid guanidium thiocyanate phenol chloroform extraction. Anal Biochem 162:156–159. Do¨hner K, Du J, Corbacioglu A, Scholl C, Schlenk RF, Do¨hner H. 2006. JAK2V617F mutations as cooperative genetic lesions in t(8;21)-positive acute myeloid leukemia. Haematologica 91:1571–1572.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

Gamou T, Kitamura E, Hosoda F, Shimizu K, Shinohara K, Hayashi Y, Nagase T, Yokoyama Y, Ohki M. 1998. The partner gene of AML1 in t(16;21) myeloid malignancies is a novel member of the MTG8(ETO) family. Blood 9:4028–4037. Hasan SK, Mays AN, Ottone T, Ledda A, La Nasa G, Cattaneo C, Borlenghi E, Melillo L, Montefusco E, Cervera J, Stephen C, Satchi G, Lennard A, Libura M, Byl JA, Osheroff N, Amadori S, Felix CA, Voso MT, Sperr WR, Esteve J, Sanz MA, Grimwade D, Francesco Lo-Coco. 2008. Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis. Blood 112:3383–3390. ISCN. 1995. An International System for Human Cytogenetic Nomenclature. Mitelman F, editor. Basel: S Karger. Lee JW, Kim YG, Soung YH, Han KJ, Kim SY, Rhim HS, Min WS, Nam SW, Park WS, Lee JY, Yoo NJ, Lee SH. 2006. The JAK2 V617F mutation in de novo acute leukemias. Oncogene 25:1434–1436. Lovett BD, Lo Nigro L, Rappaport EF, Blair IA, Osheroff N, Zheng N, Megonigal MD, Williams WR, Nowell PC, Felix CA. 2001a. Near-precise interchromosomal recombination and functional DNA topoisomerase II cleavage sites at MLL and AF-4 genomic breakpoints in treatment-related acute lymphoblastic leukemia with t(4;11) translocation. Proc Natl Acad Sci USA 98:9802–9807. Lovett BD, Strumberg D, Blair IA, Pang S, Burden DA, Megonigal MD, Rappaport EF, Rebbeck TR, Osheroff N, Pommier YG, Felix CA. 2001b. Etoposide metabolites enhance DNA topoisomerase II cleavage near leukemia-associated MLL translocation breakpoints. Biochemistry 40:1159–1170. Mirault ME, Boucher P, Tremblay A. 2006. Nucleotide-resolution mapping of topoisomerase-mediated and apoptotic DNA strand scissions at or near an MLL translocation hotspot. Am J Hum Genet 79:779–791. Mistry AR, Felix CA, Whitmarsh RJ, Mason A, Reiter A, Cassinat B, Parry A, Walz C, Wiemels JL, Segal MR, Ade`s L, Blair IA, Osheroff N, Peniket AJ, Lafage-Pochitaloff M, Cross NC, Chomienne C, Solomon E, Fenaux P, Grimwade D. 2005. DNA topoisomerase II in therapy-related acute promyelocytic leukemia. N Engl J Med 352:1529–1538. Mitelman F, Johansson B, Mertens F, editors. 2008. Mitelman Database of Chromosome Aberrations in Cancer. Available at: http://cgap.nci.nih. gov/Chromosomes/Mitelman. Noguera NI, Ammatuna E, Zangrilli D, Lavorgna S, Divona M, Buccisano F, Amadori S, Mecucci C, Falini B, Lo-Coco F. 2005. Simultaneous detection of NPM1 and FLT3-ITD mutations by capillary electrophoresis in acute myeloid leukemia. Leukemia 19:1479–1482. Nucifora G, Rowley JD. 1995. AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia. Blood 86:1– 14. Olney HJ, Mitelman F, Johansson B, Mro´zek K, Berger R, Rowley JD. 2002. Unique balanced chromosome abnormalities in treatment-related myelodysplastic syndromes and acute myeloid leukemia: Report from an International Workshop. Genes Chromosomes Cancer 33:413–423. Renneville A, Roumier C, Biggio V, Nibourel O, Boissel N, Fenaux P, Preudhomme C. 2008. Cooperating gene mutations in acute myeloid leukemia: A review of the literature. Leukemia 22:915–931. Rowley JD, Olney HJ. 2002. International workshop on the relationship of prior therapy to balanced chromosome aberrations in therapy-related myelodysplastic syndromes and acute leukemia: Overview report. Genes Chromosomes Cancer 33:331–345. Rossetti S, Van Unen L, Touw IP, Hoogeveen AT, Sacchi N. 2005. Myeloid maturation block by AML1-MTG16 is associated with Csf1r epigenetic down regulation. Oncogene 24:5325–5332. Roulston D, Espinosa R, III, Nucifora G, Larson RA, Le Beau MM, Rowley JD. 1998. CBFA2(AML1) translocations with novel partner chromosomes in myeloid leukemias: Association with prior therapy. Blood 92:2879–2885. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. New York: Cold Spring Harbor Laboratory Press. 1659 p. Schnittger S, Bacher U, Kern W, Haferlach C, Haferlach W. 2007. JAK2 seems to be a typical cooperating mutation in therapyrelated t(8;21)/AML1-ETO-positive AML. Leukemia 21:183– 184. Schoch C, Schnittger S, Klaus M, Kern W, Hiddemann W, Haferlach T. 2003. AML with 11q23/MLL abnormalities as deﬁned

HOTSPOT RUNX1 BREAKPOINT IN t(16;21) OF A t-AML by the WHO classiﬁcation: Incidence, partner chromosomes, FAB subtype, age distribution, and prognostic impact in an unselected series of 1897 cytogenetically analyzed AML cases. Blood 102:72395–72402. Shimada M, Ohtsuka E, Shimizu T, Matsumoto T, Matsushita K, Tanimoto F, Kajii T. 1997. A recurrent translocation, t(16;21)(q24;q22), associated with acute myelogenous leukemia: Identiﬁcation by ﬂuorescence in situ hybridization. Cancer Genet Cytogenet 96:102–105. Slovak ML, Bedell V, Popplewell L, Arber DA, Schoch C, Slater R. 2002. 21q22 balanced chromosome aberrations in therapyrelated hematopoietic disorders: Report from an international workshop. Genes Chromosomes Cancer 33:379–294. Stanulla M, Wang J, Chervinsky DS, Aplan PD. 1997. Topoisomerase II inhibitors induce DNA double-strand breaks at a speciﬁc site within the AML1 locus. Leukemia 11:490–496. Takeda K, Shinohara K, Kameda N, Ariyoshi K. 1998. A case of therapy-related acute myeloblastic leukemia with t(16;21) (q24;q22) after chemotherapy with DNA-topoisomerase II inhibitors, etoposide and mitoxantrone, and the alkylating agent, cyclophosphamide. Int J Hematol 67:179–86. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F,

221

Parreira A, Gameiro P, Dia’z MG, Malec M, Langerak AW, San Miguel JF, Biondi A. 1999. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 13:1901– 1908. Whitmarsh RJ, Saginario C, Zhuo Y, Hilgenfeld E, Rappaport EF, Megonigal MD, Carroll M, Liu M, Osheroff N, Cheung NK, Slater DJ, Ried T, Knutsen T, Blair IA, Felix CA. 2003. Reciprocal DNA topoisomerase II cleavage events at 50 -TATTA-30 sequences in MLL and AF-9 create homologous single-stranded overhangs that anneal to form der(11) and der(9) genomic breakpoint junctions in treatment-related AML without further processing. Oncogene 22:8448–8459. Zatkova A, Fonatsch C, Sperr WR, Valent P. 2007. A patient with de novo AML M1 and t(16;21) with karyotype evolution. Leuk Res 31:1319–1321. Zhang Y, Strissel P, Strick R, Chen J, Nucifora G, Le Beau MM, Larson RA, Rowley JD. 2002. Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia. Proc Natl Acad Sci USA 99:3070–3075.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

Chapter 6 To study the genetic markers of susceptibility to t-APL and their association with multiple sclerosis

Introduction Therapy related acute leukemia (TRAL) has been increasingly reported in patients with Multiple Sclerosis (MS). In contrast to the low incidence reported earlier (0.29%) (Ghalie et al., 2002), recent reports have documented rates of TRAL between 2% and 3% (Pascual et al., 2009). The occurrence of therapy related acute promyelocytic leukemia (t-APL) was surprisingly high (65.6%) amongst all TRAL cases arising after MS (Pascual et al., 2009). Multiple sclerosis is a heterogeneous neurological disease with different degrees of severity. In 2000 mitoxantrone (MTZ) has been approved by American Academy of Neurology with the aim to prevent the progression of the disease (Marriott et al., 2010). Since no single golden standard for disease severity exists, it is therefore crucial to take into account the reliable clinical predictors of the evolution of the disease. We considered two outcomes for the patients: the Bayesian Risk Estimate for Multiple Sclerosis (BREMS) score (Bergamaschi et al., 2007) which is calculated based on the clinical events of the first year of disease for every patient and progression index (PI). PI corresponds to the ratio between EDSS and disease duration in years. The data from previous studies have concluded that MTZ reduces clinical attack rates, MRI activity, and disease progression. MTZ exerts anti-proliferative effects on lymphocytes through several mechanisms of action, including inhibition of topoisomerase II enzyme (Fox, 2006; Komori et al., 2009; Marriott et al., 2010; Ory et al., 2008). Although several reports have implicated MTZ in inducing TRAL but the dose dependent effect of MTZ has remained controversial. Of particular note we have previously reported two MS patients who received only 30 and 35 mg cumulative dose of MTZ (Hasan et al., 2008). Besides, there were 2 MS patients who developed leukemia even without MTZ treatment (Hasan et al., 2008). In addition, one case has recently been published of a MS patient developing chronic myeloid leukemia (CML) 16 months after MTZ therapy (Sadiq et

al., 2008). CML is not a recognized TRAL in either the cancer or MS population and therefore it is unclear whether this leukemia resulted from the MTZ therapy. Given the fact that only a subset of all MS patients treated with MTZ develops t-APL suggests that these individuals may be genetically predisposed toward TRAL. There are data to suggest that genetic factors contribute to t-APL risk. In particular, variants of genes involved in DNA repair pathway are associated with increased t-APL susceptibility (Casorelli et al., 2006; Seedhouse and Russell, 2007). This led us to investigate the genetic variants of DNA repair or factors involved in genomic stability might contribute to t-APL risk in MS population. Furthermore, specific SNP variants of apoptosis and DNA damage-regulatory genes have recently been described as risk factors for MS (Satoh et al., 2005) and may hence be associated with APL developed as a second tumor (sAPL) occurring in patients with this disease. We, therefore, intend to investigate the possibility that specific genetic variants in DNA repair genes or genes that predispose to MS are significantly associated with sAPL.

Materials and methods

Patients All patients were initially divided into 2 groups. The sAPL group was composed of 20 patients in whom, primary disease was MS. The median latency between MS and sAPL was 24 months (range 4-60 months). All except 2 patients received MTZ before developing secondary leukemia. The median cumulative dose of MTZ was 105 mg (range 30-234 mg). The detailed clinical and biological features of these patients have been described elsewhere (Hasan et al., 2008) (Hasan et al 2010). The control group was defined as patients with MS (N=271) who 24 months or more after treatment did not develop a secondary malignancy. However, control group was further divided in to 2 subgroups based on the clinical status of disease that is stable vs progressive MS. Type of MS, BREMS score and progression index values were taken into account before classifying 61

them into stability and progression (Table 1). All RRMS patients with at least 24 months of followup (N=152) were considered stable while SPMS (N=34) and PPMS (N=19) were taken as a progressive form of the disease. Patients with incomplete clinical data and/or insufficient follow up were excluded from the study. We have also analyzed a group of 89 healthy individuals.

Selection criteria for genes and SNPs The selection was based on the fact that the risk of therapy related leukemia may also, in part, be due to inherited genetic factors. These factors include polymorphisms within genes encoding DNA reapir enzymes (Casorelli et al., 2006; Ruttan and Glickman, 2002; Seedhouse and Russell, 2007) (Seedhouse et al BJH 2007, casorelli et al 2003). However, there is also risk -theoretical, at least -- that disruption in DNA repair may increase the side effects of the drugs that functions through inhibiting DNA repair processess. Apart from DNA repair genes other coding variants of genes were selected prospectively based on their association either with multiple sclerosis or therapy related leukemia as demonstrated previously (Ellis et al., 2008; Felix et al., 1998; Hafler et al., 2007). We have studied 180 SNPs of 26 genes mostly relating to DNA repair pathway (ATM, BRCA1 and 2; CHK1 and 2; LIG 3 and 4; MRE11A; NBS1; PRKDC; RAD 21, 50, 51 and 52; XRCC1, 2, 3, 4, 5, and 6), apoptosis (p53; MDM2), drug detoxification pathways (CYP3A4) and genes that are associated with increased MS susceptibility (HLA-DR; IL2RA; IL7R) (Table 2).

Genotyping and quality control Genotyping was performed using MassARRAY high-throughput DNA analysis with Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (Sequenom, Inc., San Diego, CA). SNPs were genotyped using iPLEX Gold technology following manufacturer protocol (Sequenom). One hundred and eighty SNPs (Table 4) were subdivided in 9 multiplex assays, designed by MassARRAY Assay Design software (version 3.1). SNPs were 62

genotyped using iPLEX Gold technology (Sequenom). We performed multiplex PCR in a total volume of 5 µL containing: 0.5 µL of 10xBuffer (2mM MgCl2), 0.4 µL of MgCl2 (2 mM), 0.1 µL dNTPs (500 µM, 1.0 µL of primer mix (500nM each), 0.1 µL of PCR Enzyme (0.5 U/rxn) (Sequenom) and 1 µL DNA (10ng/µL), all concentrations are related to 5 µL. The cycling conditions (DNA Engine® Petier Thermal Cycler Operations Manual (BIO RAD) were 94°C for 4 minutes followed by 45 cycles at 94°C for 20 seconds, 56°C for 30 seconds and 72°C for 1 minutes, and a final extension at 72°C for 3 minutes. PCR primers and dNTPs were removed by incubation with 2 µL SAP Enzyme solution (Sequenom) at 37°C for 40 minutes, followed by 5 minutes at 85°C. The primer extension reaction were performed adding 2 µL of iPLEX Cocktail (Sequenom) containing: 0.2 µL of 10x iPLEX Buffer Plus, 0.1 µL of iPLEX Termination mix 0.94 µL of Primer mix (from 7 µM to 14 µM) and 0.041 iPLEX enzyme. The cycling conditions (DNA Engine® Petier Thermal Cycler Operations Manual (BIO RAD) were 94°C for 30 seconds, followed by 40 cycles at 94°C for 5 seconds, 52°C for 5 seconds and 80°C for 5 seconds for 5 cycles, and a final extension at 72°C for 3 minutes. Then the iPLEX Gold reaction products were desalted with Clean Resin (Sequenom); this cleanup step was important to optimize mass spectrometry analysis of the iPLEX Gold reaction products. Twenty five nL of products were spotting to the SpectroCHIP (Sequenom) using Nanodispenser (Samsung); subsequently the SpectroCHIP was analyzed in the MALDI-TOF MS (Bruker).

Statistical analysis Allele and genotype frequencies (Pearson X statistics), odd ratio (OR), 95% confidence intervals (CI) and p values, as well as dominant and recessive genetic models, were analyzed using deFinetti

program

(http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl).

Hardy-Weinberg

equilibrium of tested groups and Armitage‟s trend test (ATT) were also calculated using deFinetti. ATT assumes additive (or codominant) disease model where all disease allele are independent and have the same contribution to the disease risk. 63

For each statistically significant association found (P2 years of follow-up RRMS with >2 years of follow-up All MS patients MS patients treated with mitoxantrone MS patients without mitoxantrone treatment MS patients without mitoxantrone treatment Healthy controls (CTR) Healthy Controls (CTR)

All MS patients

271

152

SPMS+PPMS

152

MS-APL

271 18

MS-APL MS-APL

20 20

253

MS-APL

253

MS patients treated with mitoxantrone All MS patients

271

MS-APL

Table 4: SNP markers associated with risk of development of MS and/or MS-APL

Comparison Group A Healthy controls vs All MS patients

SNP rs1042522

rs1801406

gene p53

BRCA2

Genotype GG

Controls 52 (58)

Cases 126 (47)

35 (39)

119 (45)

2 (2)

20 (7)

AA AG GG

42 (47) 32 (36) 15 (17)

risk allele

OR (95% CI)

1,52 (1,02-2,2)

P value Pearson's goodnessof-fit chisquare

0,037

P value Armitage's trend test

0,030

P value Omnibus

The most significant association (test)

0,026

Allele frequency difference

0,0022

Allele positivity (AA+AG versus GG)

141 (54) 102 (39) 15 (6)

3,284 (1,53-7,03)

0,0014

0,0201

Table 4 (continued)

Comparison Group B RRMS with >2yrs of follow up vs

SNP rs1805386

gene LIG4

SPMS+PPMS

rs1063045

NBS1

Genotype TT

Controls 55 (61)

30 (34)

4 (4)

68 (46)

GA AA

61 (41) 20 (13)

Cases

risk allele

OR (95% CI)

1,82 (1,08-3,05

0,234 (0,051-1,06)

P value Pearson's goodnessof-fit chisquare

0,021

P value Armitage's trend test

0,025

P value Omnibus

The most significant association (test)

0,023

Allele frequency difference

0,05

Homozygous (GG versus AA)

29 (54) 23 (43) 2 (3)

0,04

0,09

Table 4 (continued)

Comparison Group C RRMS with >2yrs of follow up vs MS-APL

SNP rs1801406

rs2740574

gene BRCA2

CYP3A4

Genotype AA

Controls 120 (55)

Cases 8 (42)

AG GG

84 (39) 12 (6)

6 (32) 5 (26)

AA AG GG

186 (95) 9 (4,5) 1 (0,5)

risk allele

OR (95% CI)

6,25 (1,76-22,6)

6,88 (2,04-23,1)

P value Pearson's goodnessof-fit chisquare

0,0016

P value Armitage's trend test

0,022

P value Omnibus

The most significant association (test)

0,005

Homozygous (AA versus GG)

0,001

Heterozygous (AA versus AG)

15 (75,0) 5 (25) 0

0,00043

0,0030

Table 4 (continued)

Comparison

SNP

gene

Genotype

Group D All MS patients vs

rs207906

XRCC5

Controls 166 (64,1)

87 (33,6)

6 (2,3)

MS-APL

Cases 14 (70,0) 3 (15,0) 3 (15,0)

risk allele

A Group D All MS patients vs MS-APL

rs2740574

CYP3A4

251 (95,1)

15 (75,0)

AG GG

12 (4,5) 1 (0,4)

5 (25) 0

OR (95% CI)

5,9 (1,3-26,3)

6,4 (2,0-20,4)

P value Pearson's goodnessof-fit chisquare

0.0089

0.00038

P value Armitage's trend test

>0,05

0.0013

P value Omnibus

The most significant association (test)

0.019

Homozygous (GG versus AA)

0.0016

Allele positivity (AA versus AG+GG)

Table 4 (continued)

Comparison

SNP

gene

Genotype

Group D All MS patients vs

rs1801406

BRCA2

MS-APL

Group E MS patients treated with mitoxantrone vs MS-APL

rs16940

BRCA1

Controls

Cases

141 (54,7) 102 39,5)

15 (5,8)

8 (42,1) 6 (31,6) 5 (26,3)

2 (11,1)

12 (66,7)

4 (22,2)

risk allele

OR (95% CI)

5,9 (1,79-20,2)

P value Pearson's goodnessof-fit chisquare

0.0020

P value Armitage's trend test

0.027

P value Omnibus

The most significant association (test)

0.0050

Homozygous (AA versus GG)

0.0022

Allele positivity (TT versus TC+CC)

13 (65,0)

5 (25,0) 2 (10,0)

0,067 (0,012-0,38)

C* protective

0.00069

0.0039

Table 4 (continued)

Comparison

SNP

gene

Genotype

Group F MS patients without mitoxantrone vs

rs1801406

BRCA2

Controls 131 (54,6)

94 (39,2)

15 (6,3)

MS-APL

Group F MS patients without mitoxantrone vs MS-APL

rs2740574

rs207906

CYP3A4

XRCC5

Cases 8 (42,1)

15 (75,0)

AG GG

11 (4,5) 1 (0,4)

5 (25) 0

83 (34,4)

6 (2,5)

OR (95% CI)

5,46 (1,58-18,83)

7,09 (2,18-23,05)

P value Armitage's trend test

P value Omnibus

The most significant association (test)

0.0720

Homozygous (AA versus GG)

0.0011

Heterozygous (AA versus AG)

0.0430

Heterozygous (AA versus GA)

6 (31,6) 5 (26,3)

234 (95,1)

152 (63,1)

risk allele

P value Pearson's goodnessof-fit chisquare

0.0033

0.00021

0.031

0.0014

14 (70,0)

3 (15,0) 3 (15,0) 0,072 (0,012-0,44)

G* protective

0.00046

>0,05

Table 4 (continued)

Comparison

SNP

gene

Genotype

Controls

Cases

Group G MS patients without mitoxantrone vs MS patients treated with mitoxantrone

rs16940

BRCA1

105 (44,4)

2 (11,1)

106 (45,0)

12 (66,7)

25 (10,6)

4 (22,2)

risk allele

OR (95% CI)

P value Pearson's goodnessof-fit chisquare

8,4 (1,46-48,46)

0.005

P value Armitage's trend test

P value Omnibus

The most significant association (test)

0.005

0.0170

Homozygous (TT versus CC)

References Bergamaschi, R., Quaglini, S., Trojano, M., Amato, M.P., Tavazzi, E., Paolicelli, D., Zipoli, V., Romani, A., Fuiani, A., Portaccio, E., et al. (2007). Early prediction of the long term evolution of multiple sclerosis: the Bayesian Risk Estimate for Multiple Sclerosis (BREMS) score. J Neurol Neurosurg Psychiatry 78, 757-759.

Casorelli, I., Tenedini, E., Tagliafico, E., Blasi, M.F., Giuliani, A., Crescenzi, M., Pelosi, E., Testa, U., Peschle, C., Mele, L., et al. (2006). Identification of a molecular signature for leukemic promyelocytes and their normal counterparts: Focus on DNA repair genes. Leukemia 20, 19781988.

Ellis, N.A., Huo, D., Yildiz, O., Worrillow, L.J., Banerjee, M., Le Beau, M.M., Larson, R.A., Allan, J.M., and Onel, K. (2008). MDM2 SNP309 and TP53 Arg72Pro interact to alter therapy-related acute myeloid leukemia susceptibility. Blood 112, 741-749.

Felix, C.A., Walker, A.H., Lange, B.J., Williams, T.M., Winick, N.J., Cheung, N.K., Lovett, B.D., Nowell, P.C., Blair, I.A., and Rebbeck, T.R. (1998). Association of CYP3A4 genotype with treatment-related leukemia. Proc Natl Acad Sci U S A 95, 13176-13181.

Fox, E.J. (2006). Management of worsening multiple sclerosis with mitoxantrone: a review. Clin Ther 28, 461-474.

Ghalie, R.G., Mauch, E., Edan, G., Hartung, H.P., Gonsette, R.E., Eisenmann, S., Le Page, E., Butine, M.D., and De Goodkin, D.E. (2002). A study of therapy-related acute leukaemia after mitoxantrone therapy for multiple sclerosis. Mult Scler 8, 441-445.

Greenacre, M. (1992). Correspondence analysis in medical research. Stat Methods Med Res 1, 97117.

Greenacre, M. (2010). Correspondence analysis of raw data. Ecology 91, 958-963.

Hafler, D.A., Compston, A., Sawcer, S., Lander, E.S., Daly, M.J., De Jager, P.L., de Bakker, P.I., Gabriel, S.B., Mirel, D.B., Ivinson, A.J., et al. (2007). Risk alleles for multiple sclerosis identified by a genomewide study. N Engl J Med 357, 851-862. 80

Hasan, S.K., Mays, A.N., Ottone, T., Ledda, A., La Nasa, G., Cattaneo, C., Borlenghi, E., Melillo, L., Montefusco, E., Cervera, J., et al. (2008). Molecular analysis of t(15;17) genomic breakpoints in secondary acute promyelocytic leukemia arising after treatment of multiple sclerosis. Blood 112, 3383-3390.

Hasan, S.K., Ottone, T., et al. (2010). Analysis of t(15;17) chromosomal breakpoint sequences in therapy-related versus de novo acute promyelocytic leukemia: Association of DNA breaks with specific DNA motifs at PML and RARA loci. Genes Chomosomes and Cancer 2010 (Early online Publication DOI: 10.1002/gcc.20783)

Knight, J.A., Skol, A.D., Shinde, A., Hastings, D., Walgren, R.A., Shao, J., Tennant, T.R., Banerjee, M., Allan, J.M., Le Beau, M.M., et al. (2009).

Genome-wide association study to identify novel loci associated with therapy-related myeloid leukemia susceptibility. Blood 113, 5575-5582.

Komori, M., Kondo, T., and Tanaka, M. (2009). [Mitoxantrone for the treatment of patients with multiple sclerosis]. Brain Nerve 61, 575-580.

Marriott, J.J., Miyasaki, J.M., Gronseth, G., and O'Connor, P.W. (2010). Evidence Report: The efficacy and safety of mitoxantrone (Novantrone) in the treatment of multiple sclerosis: Report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology. Neurology 74, 1463-1470.

Nickoloff, J.A., De Haro, L.P., Wray, J., and Hromas, R. (2008). Mechanisms of leukemia translocations. Curr Opin Hematol 15, 338-345.

Ory, S., Debouverie, M., Le Page, E., Pelletier, J., Malikova, I., Gout, O., Roullet, E., Vermersch, P., and Edan, G. (2008). [Use of mitoxantrone in early multiple sclerosis with malignant disease course. Observational study in 30 patients with clinical and MRI outcomes after one year]. Rev Neurol (Paris) 164, 1028-1034.

Pascual, A.M., Tellez, N., Bosca, I., Mallada, J., Belenguer, A., Abellan, I., Sempere, A.P., Fernandez, P., Magraner, M.J., Coret, F., et al. (2009). Revision of the risk of secondary leukaemia after mitoxantrone in multiple sclerosis populations is required. Mult Scler 15, 1303-1310. Roca, J. (2009). Topoisomerase II: a fitted mechanism for the chromatin landscape. Nucleic Acids Res 37, 721-730.

Ruttan, C.C., and Glickman, B.W. (2002). Coding variants in human double-strand break DNA repair genes. Mutat Res 509, 175-200.

Sadiq, S.A., Rammal, M., and Sara, G. (2008). Chronic myeloid leukemia associated with mitoxantrone treatment in a patient with MS. Mult Scler 14, 272-273.

Satoh, J., Nakanishi, M., Koike, F., Miyake, S., Yamamoto, T., Kawai, M., Kikuchi, S., Nomura, K., Yokoyama, K., Ota, K., et al. (2005). Microarray analysis identifies an aberrant expression of apoptosis and DNA damage-regulatory genes in multiple sclerosis. Neurobiol Dis 18, 537-550. Seedhouse, C., and Russell, N. (2007). Advances in the understanding of susceptibility to treatment-related acute myeloid leukaemia. Br J Haematol 137, 513-529.

Wacholder, S., Chanock, S., Garcia-Closas, M., El Ghormli, L., and Rothman, N. (2004). Assessing the probability that a positive report is false: an approach for molecular epidemiology studies. J Natl Cancer Inst 96, 434-442.

Chapter 7 Conclusions and future directions

The work described throughout this thesis has provided credible evidences to support the notion that topoisomerase II plays a central role in the generation of chromosomal translocations. In the current study this mechanism of chromosomal rearrangements mediating via topoisomerase II has largely been demonstrated either in patients who had received topoisomerase II inhibitor before developing leukemic chromosomal translocation or by utilizing information derived from patient‟s DNA samples in in vitro DNA cleavage assays. To this end we have convincingly showed that specific genomic loci within the genome, for example PML intron 6, RUNX1 intron 5 and RARA intron 2 at specific locations, are preferential sites of topoisomerase II mediated DNA damage which was significantly enhanced in the presence of chemotherapeutics agents targeting this enzyme. Prof Neil Osheroff rightly describes this enzyme (Nucleic Acids Res, 2009) as having Dr. Jekyll/Mr. Hyde character; on one hand proliferating cells cannot exist without topoisomerase II, thereofore it is absolutely essential to cell viability, on the other hand this enzyme has enormous capacity to fragment the genome. Considering the fact that therapy related leukemia when arises after treatment of primary cancer which involves a number of chemotherapeutics agents and many of these agents have leukemogenic potential which makes it difficult to ascribe a particular role to a specific agent in inducing leukemia. In this context leukemia arising after non malignant disorder such as multiple sclerosis acts as a model system. It provides an opportunity to understand the role of a specific agent that is mitoxantrone, which is used as a single agent chemotherapy with the aim to prevent the disease progression, in inducing chromosomal translocation. During this study we have also noticed that only a subset of all multiple sclerosis patients treated with mitoxantrone develops leukemia which suggests that these individuals may be genetically predisposed toward therapy related leukemia. To address this issue we undertook a study based on genetic variations of DNA repair genes. . This study has shown that the genetic variants of BRCA2 (rs rs1801406), XRCC5 (rs207906), and CYP3A4 (rs2740574) may predispose multiple sclerosis patients at higher risk to 84

develop leukemia. Currently we are in the process to confirm and validate these results. Therefore we are cautious about drawing any firm conclusion at this point of time. In spite of putting all the efforts in order to understand the mechanism of chromosomal translocations, there are still some questions that needs to be addressed in future studies. For example during this study we hypothesize the potential role of non-homologous end joining pathway (NHEJ) in the generation of translocations during cleavage-religation process in the presence of topoisomerase II at broken ends of DNA but one has to demonstrate precisely in vivo why NHEJ pathway at some time functions erroneously in the presence of DNA damage resulting either from endogenous or exogenous stimulation? However one would not expect topoisomerase II cleavage to depend upon DNA sequence only considering that enzyme alter the topology of supercoiled DNA throughout the entire genome.

Acknowledgments My last remaining task is to acknowledge all those people that have contributed to the work described in this thesis. This is an impossible task, given the many people that have helped to design, implement, apply, and criticize the work. I am going to try anyway, and if your name is not listed, rest assured that my gratitude is not less than for those listed below. This thesis would not have been possible without the kind support and encouragement of my supervisor Professor Francesco Lo-Coco, whose, guidance from the initial to the final level enabled me to develop an understanding of the subject. He was always there to listen and to give advice. Undoubtedly he is an outstanding clinician-scientist I have ever met. He showed me different ways to approach a research problem and the need to be persistent to accomplish any goal. Under his supervision, I have developed project, research paper and book chapter writing skills. It has been an absolute honor to be his first foreign Ph.D. student. I sincerely appreciate all his contributions of time, ideas, and funding to make my Ph.D. experience productive and stimulating. Next, I owe my deepest gratitude to Professor Sergio Amadori, who has provided the clinical insights at many occasions that have improved my knowledge at that front, as well as his academic experience, have been invaluable to me. Very special thanks goes to Professor David Grimwade and Ashley N Mays at University College of London, who are most responsible for helping me to complete the writing of this thesis as well as the challenging research that lies behind it. Professor Grimwade has been a friend and mentor who improved my paper writing skills and inspired me a lot with his long working hours even on Sundays. Without his encouragement and constant guidance, I could not have finished this work. Ashley has helped for crucial in vitro cleavage assays and has graciously provided relevant pictures for my thesis. I am most grateful to Tiziana Ottone, Susanna Dolci, Manuela Pelligrini Serena, Emanuele, Nelida, Ettore and Florencia with whom I have spent significant amount of time during the last three and half years. Each time I proposed an interesting topic, either academic or not, these people just suffocate me with all kinds of creative suggestions and solutions. I owe lots of gratitudes to a number of faculty members of the Department of Hematology, Tor Vergata including Professors William Arcese, Adriano Venditti and Francesco Bucissano. All the members of the “Oppo” laboratory have contributed immensely to my personal and professional time at Tor Vergata. The “Oppo” group has been a source of friendships as well as good advice and collaboration. I would like to extend my sincere thanks to Dr Diego Centonze and Fabio, Department of Neurosciences, „Tor Vergata‟, and Professor PG Pelicci, Myriam Alcalay, Lucilla Luzi, Ivan 86

Dellino and Francesca De Santis, all at European Institute of Oncology, Milan who have helped in many different ways either by providing precious patient samples, constructive suggestions or by providing reagents and space to work and critical bioinformatics (Lucilla) support whenever I was looking for it. My heartfelt thanks to Professor Lucio Luzzatto and Professor Neil Osheroff, who made me interested in genomic breakpoint analysis and topoisomerase II studies respectively. I am extremely grateful to my Indian friends in Rome as well in India specially Dr Pankhi Dutta, Dr Prantar, Bijender, Gaurav, Shiv, Sidhu, Girish, Martin and Murugan. They have been very supportive throughout my work. Last but not least, I would like to thank my family, and especially my mother and elder brother Azhar (Bhai Sahab) for always supporting and imparting the best of education in me. Perhaps, I forgot someone… so, just in case: thank you to whom it concerns!